EMAIL THIS PAGE TO A FRIEND

KLHL23

kelch-like family member 23

55 Gene Product Result for
Synonyms: DITHP
UniProtKB ID: Q8NBE8, Q8N9B9, Q96FT8
Gene ID:
Mouse(277396) kelch-like 23
Rat(311114) kelch-like family member 23
Zebrafish(559613) kelch-like 23 (Drosophila)
cow(100140861) kelch-like 23 (Drosophila)
Horse(100052649) kelch-like 23 (Drosophila)
domestic cat(101086994) kelch-like 23 (Drosophila)
dog(488392) kelch-like 23 (Drosophila)
chicken(429025) kelch-like 23 (Drosophila)
sheep(101118851) kelch-like 23 (Drosophila)
domestic guinea pig(100731969) kelch-like family member 23
naked mole-rat(101723291) kelch-like family member 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303309 ANTI-KLHL23 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB2101284 Anti-KLHL23 antibody produced in rabbit affinity isolated antibody human, rat, bovine, mouse, dog, guinea pig, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU083351 MISSION® esiRNA esiRNA targeting mouse Klhl23 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144711 Rosetta Predictions human pricing
XM_001059088 Rosetta Predictions rat pricing
XM_230006 Rosetta Predictions rat pricing
NM_177784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364650 predicted 1336
2 SASI_Hs01_00037660 predicted 1384
3 SASI_Hs01_00037661 predicted 1526
4 SASI_Hs02_00364651 predicted 999
5 SASI_Hs01_00037662 predicted 1895
6 SASI_Hs01_00037663 predicted 1932
7 SASI_Hs01_00037665 predicted 1404
8 SASI_Hs01_00037666 predicted 1849
9 SASI_Hs01_00037667 predicted 916
10 SASI_Hs02_00364652 predicted 1356
11 SASI_Hs01_00037659 predicted 1005
12 SASI_Hs01_00037664 predicted 1502
13 SASI_Hs01_00037668 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291874 predicted 269
2 SASI_Rn02_00291875 predicted 1029
3 SASI_Rn02_00291876 predicted 1164
4 SASI_Rn02_00291877 predicted 1767
5 SASI_Rn02_00291878 predicted 1084
6 SASI_Rn02_00291879 predicted 1152
7 SASI_Rn02_00291880 predicted 461
8 SASI_Rn02_00291881 predicted 1105
9 SASI_Rn02_00291882 predicted 1015
10 SASI_Rn02_00291883 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386082 predicted 1410
2 SASI_Rn02_00386083 predicted 1553
3 SASI_Rn02_00386084 predicted 1467
4 SASI_Rn02_00386085 predicted 1534
5 SASI_Rn02_00386086 predicted 850
6 SASI_Rn02_00386087 predicted 1491
7 SASI_Rn02_00386088 predicted 1391
8 SASI_Rn02_00386089 predicted 1636
9 SASI_Rn02_00386090 predicted 1138
10 SASI_Rn02_00386091 predicted 1901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146605 predicted 1039
2 SASI_Mm01_00146606 predicted 263
3 SASI_Mm01_00146607 predicted 1897
4 SASI_Mm01_00146608 predicted 851
5 SASI_Mm01_00146609 predicted 1726
6 SASI_Mm01_00146610 predicted 840
7 SASI_Mm01_00146611 predicted 1111
8 SASI_Mm01_00146612 predicted 760
9 SASI_Mm01_00146613 predicted 1756
10 SASI_Mm02_00348218 predicted 1239
11 SASI_Mm01_00146604 predicted 832
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144711
VALIDATED
KLHL23 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 23
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-1401s21c1
Sequence:CCGGATGCTCAATGCCAGGTATTACCTCGAGGTAATACCTGGCATTGAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-503s21c1
Sequence:CCGGAGCTGCTTGCAGCAATTATTTCTCGAGAAATAATTGCTGCAAGCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-934s21c1
Sequence:CCGGCTATCATAGAGCCAGTTATTACTCGAGTAATAACTGGCTCTATGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_144711.3-1310s1c1
Sequence:CCGGCCTGTGTCTTACATGATGTTACTCGAGTAACATCATGTAAGACACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-727s21c1
Sequence:CCGGTGGTAAGGCACTTGGATATTGCTCGAGCAATATCCAAGTGCCTTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-1087s21c1
Sequence:CCGGATAAGATCCGCTCCCTAATATCTCGAGATATTAGGGAGCGGATCTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-1530s21c1
Sequence:CCGGCCTATTGCAAACATGATTAAACTCGAGTTTAATCATGTTTGCAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_144711.3-2549s1c1
Sequence:CCGGCTACCTTTGTAGTGAATCTTTCTCGAGAAAGATTCACTACAAAGGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144711.3-1234s1c1
Sequence:CCGGGCTGAGTTCTATGATCCTTTACTCGAGTAAAGGATCATAGAACTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_144711.3-958s1c1
Sequence:CCGGCCTTTGACAAATGTTTGGATTCTCGAGAATCCAAACATTTGTCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144711.3-732s1c1
Sequence:CCGGCCTCTATAATCTACTGAGCTACTCGAGTAGCTCAGTAGATTATAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144711
VALIDATED
KLHL23 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 23
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-1401s21c1
Sequence:CCGGATGCTCAATGCCAGGTATTACCTCGAGGTAATACCTGGCATTGAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-503s21c1
Sequence:CCGGAGCTGCTTGCAGCAATTATTTCTCGAGAAATAATTGCTGCAAGCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-934s21c1
Sequence:CCGGCTATCATAGAGCCAGTTATTACTCGAGTAATAACTGGCTCTATGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_144711.3-1310s1c1
Sequence:CCGGCCTGTGTCTTACATGATGTTACTCGAGTAACATCATGTAAGACACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-727s21c1
Sequence:CCGGTGGTAAGGCACTTGGATATTGCTCGAGCAATATCCAAGTGCCTTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-1087s21c1
Sequence:CCGGATAAGATCCGCTCCCTAATATCTCGAGATATTAGGGAGCGGATCTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-1530s21c1
Sequence:CCGGCCTATTGCAAACATGATTAAACTCGAGTTTAATCATGTTTGCAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_144711.3-2549s1c1
Sequence:CCGGCTACCTTTGTAGTGAATCTTTCTCGAGAAAGATTCACTACAAAGGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144711.3-1234s1c1
Sequence:CCGGGCTGAGTTCTATGATCCTTTACTCGAGTAAAGGATCATAGAACTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_144711.3-958s1c1
Sequence:CCGGCCTTTGACAAATGTTTGGATTCTCGAGAATCCAAACATTTGTCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144711.3-732s1c1
Sequence:CCGGCCTCTATAATCTACTGAGCTACTCGAGTAGCTCAGTAGATTATAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144711
VALIDATED
KLHL23 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 23
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-1401s21c1
Sequence:CCGGATGCTCAATGCCAGGTATTACCTCGAGGTAATACCTGGCATTGAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-503s21c1
Sequence:CCGGAGCTGCTTGCAGCAATTATTTCTCGAGAAATAATTGCTGCAAGCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-934s21c1
Sequence:CCGGCTATCATAGAGCCAGTTATTACTCGAGTAATAACTGGCTCTATGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_144711.3-1310s1c1
Sequence:CCGGCCTGTGTCTTACATGATGTTACTCGAGTAACATCATGTAAGACACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-727s21c1
Sequence:CCGGTGGTAAGGCACTTGGATATTGCTCGAGCAATATCCAAGTGCCTTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-1087s21c1
Sequence:CCGGATAAGATCCGCTCCCTAATATCTCGAGATATTAGGGAGCGGATCTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144711.4-1530s21c1
Sequence:CCGGCCTATTGCAAACATGATTAAACTCGAGTTTAATCATGTTTGCAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_144711.3-2549s1c1
Sequence:CCGGCTACCTTTGTAGTGAATCTTTCTCGAGAAAGATTCACTACAAAGGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144711.3-1234s1c1
Sequence:CCGGGCTGAGTTCTATGATCCTTTACTCGAGTAAAGGATCATAGAACTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_144711.3-958s1c1
Sequence:CCGGCCTTTGACAAATGTTTGGATTCTCGAGAATCCAAACATTTGTCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144711.3-732s1c1
Sequence:CCGGCCTCTATAATCTACTGAGCTACTCGAGTAGCTCAGTAGATTATAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177784
VALIDATED
KLHL23 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 23
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-1746s1c1
Sequence:CCGGCAGAGTATCGAGAAATACGATCTCGAGATCGTATTTCTCGATACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-3903s1c1
Sequence:CCGGGCAGTCTAACAGTGAAATAAACTCGAGTTTATTTCACTGTTAGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-3766s1c1
Sequence:CCGGGCTAAATAACACAAGCTGTTACTCGAGTAACAGCTTGTGTTATTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-1767s1c1
Sequence:CCGGCCAGATCTTAATAAGTGGGAACTCGAGTTCCCACTTATTAAGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.2-661s1c1
Sequence:CCGGGCTCCAGGTTTAAGGAAGTTTCTCGAGAAACTTCCTTAAACCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.3-1076s1c1
Sequence:CCGGGAGCAGAAATACCAGATTATACTCGAGTATAATCTGGTATTTCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.3-1363s1c1
Sequence:CCGGCCTATCGCAAACATGATTAAACTCGAGTTTAATCATGTTTGCGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.3-828s1c1
Sequence:CCGGCTACAACCTGCTAAGCTATATCTCGAGATATAGCTTAGCAGGTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.2-625s1c1
Sequence:CCGGGCTCAGAACTAGAGAAGGAATCTCGAGATTCCTTCTCTAGTTCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177784
VALIDATED
KLHL23 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 23
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-1746s1c1
Sequence:CCGGCAGAGTATCGAGAAATACGATCTCGAGATCGTATTTCTCGATACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-3903s1c1
Sequence:CCGGGCAGTCTAACAGTGAAATAAACTCGAGTTTATTTCACTGTTAGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-3766s1c1
Sequence:CCGGGCTAAATAACACAAGCTGTTACTCGAGTAACAGCTTGTGTTATTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-1767s1c1
Sequence:CCGGCCAGATCTTAATAAGTGGGAACTCGAGTTCCCACTTATTAAGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.2-661s1c1
Sequence:CCGGGCTCCAGGTTTAAGGAAGTTTCTCGAGAAACTTCCTTAAACCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.3-1076s1c1
Sequence:CCGGGAGCAGAAATACCAGATTATACTCGAGTATAATCTGGTATTTCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.3-1363s1c1
Sequence:CCGGCCTATCGCAAACATGATTAAACTCGAGTTTAATCATGTTTGCGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.3-828s1c1
Sequence:CCGGCTACAACCTGCTAAGCTATATCTCGAGATATAGCTTAGCAGGTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.2-625s1c1
Sequence:CCGGGCTCAGAACTAGAGAAGGAATCTCGAGATTCCTTCTCTAGTTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177784
VALIDATED
KLHL23 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 23
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-1746s1c1
Sequence:CCGGCAGAGTATCGAGAAATACGATCTCGAGATCGTATTTCTCGATACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-3903s1c1
Sequence:CCGGGCAGTCTAACAGTGAAATAAACTCGAGTTTATTTCACTGTTAGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-3766s1c1
Sequence:CCGGGCTAAATAACACAAGCTGTTACTCGAGTAACAGCTTGTGTTATTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177784.2-1767s1c1
Sequence:CCGGCCAGATCTTAATAAGTGGGAACTCGAGTTCCCACTTATTAAGATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.2-661s1c1
Sequence:CCGGGCTCCAGGTTTAAGGAAGTTTCTCGAGAAACTTCCTTAAACCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.3-1076s1c1
Sequence:CCGGGAGCAGAAATACCAGATTATACTCGAGTATAATCTGGTATTTCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.3-1363s1c1
Sequence:CCGGCCTATCGCAAACATGATTAAACTCGAGTTTAATCATGTTTGCGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.3-828s1c1
Sequence:CCGGCTACAACCTGCTAAGCTATATCTCGAGATATAGCTTAGCAGGTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177784.2-625s1c1
Sequence:CCGGGCTCAGAACTAGAGAAGGAATCTCGAGATTCCTTCTCTAGTTCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)