EMAIL THIS PAGE TO A FRIEND

KLHL24

kelch-like family member 24

132 Gene Product Result for
Synonyms: DRE1 KRIP6
UniProtKB ID: Q6TFL4, A5PLN8, Q9H620, Q9NXT9
Gene ID:
Mouse(75785) kelch-like 24
Rat(303803) kelch-like family member 24
domestic guinea pig(100722021) kelch-like family member 24
naked mole-rat(101721024) kelch-like family member 24
sheep(101102691) kelch-like 24 (Drosophila)
Domestic Rabbit(100352178) kelch-like 24 (Drosophila)
Zebrafish(768198) kelch-like 24 (Drosophila)
chicken(424763) kelch-like 24 (Drosophila)
dog(478647) kelch-like 24 (Drosophila)
domestic cat(101091553) kelch-like 24 (Drosophila)
cow(533510) kelch-like 24 (Drosophila)
Horse(100058815) kelch-like 24 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017644 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017644 Rosetta Predictions human pricing
NM_181473 Rosetta Predictions rat pricing
NM_029436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163036 predicted 2047
2 SASI_Hs01_00163037 predicted 1110
3 SASI_Hs01_00163038 predicted 1306
4 SASI_Hs02_00350341 predicted 724
5 SASI_Hs01_00163039 predicted 1749
6 SASI_Hs01_00163040 predicted 1135
7 SASI_Hs01_00163041 predicted 1000
8 SASI_Hs02_00350342 predicted 2040
9 SASI_Hs02_00350343 predicted 1821
10 SASI_Hs01_00163042 predicted 715
11 SASI_Hs01_00163043 predicted 1799
12 SASI_Hs01_00163044 predicted 662
13 SASI_Hs01_00163045 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062864 predicted 1906
2 SASI_Rn01_00062865 predicted 1534
3 SASI_Rn02_00269744 predicted 1924
4 SASI_Rn01_00062866 predicted 1972
5 SASI_Rn01_00062867 predicted 1117
6 SASI_Rn01_00062869 predicted 1143
7 SASI_Rn01_00062871 predicted 1887
8 SASI_Rn01_00062872 predicted 511
9 SASI_Rn01_00062873 predicted 1624
10 SASI_Rn02_00269745 predicted 1227
11 SASI_Rn01_00062868 predicted 1762
12 SASI_Rn01_00062870 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067385 predicted 542
2 SASI_Mm02_00335358 predicted 1992
3 SASI_Mm01_00067386 predicted 1690
4 SASI_Mm01_00067387 predicted 1206
5 SASI_Mm01_00067388 predicted 2041
6 SASI_Mm01_00067389 predicted 1238
7 SASI_Mm01_00067390 predicted 1289
8 SASI_Mm01_00067392 predicted 1501
9 SASI_Mm02_00335359 predicted 885
10 SASI_Mm01_00067393 predicted 1078
11 SASI_Mm01_00067384 predicted 1031
12 SASI_Mm01_00067391 predicted 2027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017644
VALIDATED
KLHL24 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 24
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017644.3-1071s21c1
Sequence:CCGGTGTTGCATCCCAACTACTTTGCTCGAGCAAAGTAGTTGGGATGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017644.3-2487s21c1
Sequence:CCGGGCATGACTTGAGGCATCATTTCTCGAGAAATGATGCCTCAAGTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017644.3-1820s21c1
Sequence:CCGGGGACTGACCAAGGCAATATACCTCGAGGTATATTGCCTTGGTCAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-776s1c1
Sequence:CCGGGAGCAACTTGATCCTTGTAATCTCGAGATTACAAGGATCAAGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-2052s1c1
Sequence:CCGGGCTGTGTGACTATTCATAGATCTCGAGATCTATGAATAGTCACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017644.3-470s21c1
Sequence:CCGGTTTCGTGATAGCCGCTTATTCCTCGAGGAATAAGCGGCTATCACGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1373s1c1
Sequence:CCGGGCTCTAAGGAATGACATTCTTCTCGAGAAGAATGTCATTCCTTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1133s1c1
Sequence:CCGGGAGTGTTATCAGTTGTTGCATCTCGAGATGCAACAACTGATAACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1727s1c1
Sequence:CCGGGAAACCAATTCTTGGCTACTTCTCGAGAAGTAGCCAAGAATTGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017644.3-1417s21c1
Sequence:CCGGCCGTGATGTCTGGATTTATAACTCGAGTTATAAATCCAGACATCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1560s1c1
Sequence:CCGGGCAGCGTAGAATGTTATGATTCTCGAGAATCATAACATTCTACGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017644
VALIDATED
KLHL24 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 24
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017644.3-1071s21c1
Sequence:CCGGTGTTGCATCCCAACTACTTTGCTCGAGCAAAGTAGTTGGGATGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017644.3-2487s21c1
Sequence:CCGGGCATGACTTGAGGCATCATTTCTCGAGAAATGATGCCTCAAGTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017644.3-1820s21c1
Sequence:CCGGGGACTGACCAAGGCAATATACCTCGAGGTATATTGCCTTGGTCAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-776s1c1
Sequence:CCGGGAGCAACTTGATCCTTGTAATCTCGAGATTACAAGGATCAAGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-2052s1c1
Sequence:CCGGGCTGTGTGACTATTCATAGATCTCGAGATCTATGAATAGTCACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017644.3-470s21c1
Sequence:CCGGTTTCGTGATAGCCGCTTATTCCTCGAGGAATAAGCGGCTATCACGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1373s1c1
Sequence:CCGGGCTCTAAGGAATGACATTCTTCTCGAGAAGAATGTCATTCCTTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1133s1c1
Sequence:CCGGGAGTGTTATCAGTTGTTGCATCTCGAGATGCAACAACTGATAACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1727s1c1
Sequence:CCGGGAAACCAATTCTTGGCTACTTCTCGAGAAGTAGCCAAGAATTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017644.3-1417s21c1
Sequence:CCGGCCGTGATGTCTGGATTTATAACTCGAGTTATAAATCCAGACATCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1560s1c1
Sequence:CCGGGCAGCGTAGAATGTTATGATTCTCGAGAATCATAACATTCTACGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017644
VALIDATED
KLHL24 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 24
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017644.3-1071s21c1
Sequence:CCGGTGTTGCATCCCAACTACTTTGCTCGAGCAAAGTAGTTGGGATGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017644.3-2487s21c1
Sequence:CCGGGCATGACTTGAGGCATCATTTCTCGAGAAATGATGCCTCAAGTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017644.3-1820s21c1
Sequence:CCGGGGACTGACCAAGGCAATATACCTCGAGGTATATTGCCTTGGTCAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-776s1c1
Sequence:CCGGGAGCAACTTGATCCTTGTAATCTCGAGATTACAAGGATCAAGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-2052s1c1
Sequence:CCGGGCTGTGTGACTATTCATAGATCTCGAGATCTATGAATAGTCACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017644.3-470s21c1
Sequence:CCGGTTTCGTGATAGCCGCTTATTCCTCGAGGAATAAGCGGCTATCACGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1373s1c1
Sequence:CCGGGCTCTAAGGAATGACATTCTTCTCGAGAAGAATGTCATTCCTTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1133s1c1
Sequence:CCGGGAGTGTTATCAGTTGTTGCATCTCGAGATGCAACAACTGATAACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1727s1c1
Sequence:CCGGGAAACCAATTCTTGGCTACTTCTCGAGAAGTAGCCAAGAATTGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017644.3-1417s21c1
Sequence:CCGGCCGTGATGTCTGGATTTATAACTCGAGTTATAAATCCAGACATCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017644.2-1560s1c1
Sequence:CCGGGCAGCGTAGAATGTTATGATTCTCGAGAATCATAACATTCTACGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029436
VALIDATED
KLHL24 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 24
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029436.3-3081s1c1
Sequence:CCGGGCGTCCACTAAAGAATTTCTTCTCGAGAAGAAATTCTTTAGTGGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-417s21c1
Sequence:CCGGTTCCGAGACAGCCGCTTATTCCTCGAGGAATAAGCGGCTGTCTCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-1206s21c1
Sequence:CCGGGAACGAGTTGGAGGATTTAATCTCGAGATTAAATCCTCCAACTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-1935s21c1
Sequence:CCGGTACGATCCTGCGACAAGTATCCTCGAGGATACTTGTCGCAGGATCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029436.3-1999s1c1
Sequence:CCGGGCTGTGTAACTATTCATAGATCTCGAGATCTATGAATAGTTACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029436.3-1909s1c1
Sequence:CCGGGAGAAGCCACAGATACTATTCCTCGAGGAATAGTATCTGTGGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029436.3-1206s1c1
Sequence:CCGGGAACGAGTTGGAGGATTTAATCTCGAGATTAAATCCTCCAACTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029436.3-4893s21c1
Sequence:CCGGTCATTCTGTTATCCCATAATTCTCGAGAATTATGGGATAACAGAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-1362s21c1
Sequence:CCGGAGCCGTGATGTCTGGATTTATCTCGAGATAAATCCAGACATCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029436
VALIDATED
KLHL24 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 24
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029436.3-3081s1c1
Sequence:CCGGGCGTCCACTAAAGAATTTCTTCTCGAGAAGAAATTCTTTAGTGGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-417s21c1
Sequence:CCGGTTCCGAGACAGCCGCTTATTCCTCGAGGAATAAGCGGCTGTCTCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-1206s21c1
Sequence:CCGGGAACGAGTTGGAGGATTTAATCTCGAGATTAAATCCTCCAACTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-1935s21c1
Sequence:CCGGTACGATCCTGCGACAAGTATCCTCGAGGATACTTGTCGCAGGATCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029436.3-1999s1c1
Sequence:CCGGGCTGTGTAACTATTCATAGATCTCGAGATCTATGAATAGTTACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029436.3-1909s1c1
Sequence:CCGGGAGAAGCCACAGATACTATTCCTCGAGGAATAGTATCTGTGGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029436.3-1206s1c1
Sequence:CCGGGAACGAGTTGGAGGATTTAATCTCGAGATTAAATCCTCCAACTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029436.3-4893s21c1
Sequence:CCGGTCATTCTGTTATCCCATAATTCTCGAGAATTATGGGATAACAGAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-1362s21c1
Sequence:CCGGAGCCGTGATGTCTGGATTTATCTCGAGATAAATCCAGACATCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029436
VALIDATED
KLHL24 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 24
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029436.3-3081s1c1
Sequence:CCGGGCGTCCACTAAAGAATTTCTTCTCGAGAAGAAATTCTTTAGTGGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-417s21c1
Sequence:CCGGTTCCGAGACAGCCGCTTATTCCTCGAGGAATAAGCGGCTGTCTCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-1206s21c1
Sequence:CCGGGAACGAGTTGGAGGATTTAATCTCGAGATTAAATCCTCCAACTCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-1935s21c1
Sequence:CCGGTACGATCCTGCGACAAGTATCCTCGAGGATACTTGTCGCAGGATCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029436.3-1999s1c1
Sequence:CCGGGCTGTGTAACTATTCATAGATCTCGAGATCTATGAATAGTTACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029436.3-1909s1c1
Sequence:CCGGGAGAAGCCACAGATACTATTCCTCGAGGAATAGTATCTGTGGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029436.3-1206s1c1
Sequence:CCGGGAACGAGTTGGAGGATTTAATCTCGAGATTAAATCCTCCAACTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029436.3-4893s21c1
Sequence:CCGGTCATTCTGTTATCCCATAATTCTCGAGAATTATGGGATAACAGAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029436.3-1362s21c1
Sequence:CCGGAGCCGTGATGTCTGGATTTATCTCGAGATAAATCCAGACATCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)