EMAIL THIS PAGE TO A FRIEND

KLHL25

kelch-like family member 25

82 Gene Product Result for
Synonyms: ENC-2 ENC2
UniProtKB ID: Q9H0H3, B3KRT7
Gene ID:
Mouse(207952) kelch-like 25
Rat(293023) kelch-like family member 25
chicken(770701) kelch-like 25 (Drosophila)
domestic cat(101092520) kelch-like 25 (Drosophila)
dog(488725) kelch-like 25 (Drosophila)
Horse(100054132) kelch-like 25 (Drosophila)
cow(529905) kelch-like 25 (Drosophila)
sheep(101121124) kelch-like 25 (Drosophila)
Domestic Rabbit(100340873) kelch-like 25 (Drosophila)
domestic guinea pig(100732319) kelch-like family member 25
naked mole-rat(101721962) kelch-like family member 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022480 Rosetta Predictions human pricing
NM_001039006 Rosetta Predictions rat pricing
NM_001122780 Rosetta Predictions mouse pricing
NM_029652 Rosetta Predictions mouse pricing
NM_182782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104412 predicted 707
2 SASI_Hs01_00104413 predicted 2275
3 SASI_Hs01_00104414 predicted 572
4 SASI_Hs01_00104415 predicted 1404
5 SASI_Hs01_00104416 predicted 1729
6 SASI_Hs01_00104418 predicted 792
7 SASI_Hs01_00104419 predicted 1324
8 SASI_Hs01_00104420 predicted 747
9 SASI_Hs01_00104421 predicted 2261
10 SASI_Hs02_00355760 predicted 2115
11 SASI_Hs01_00104417 predicted 1612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074356 predicted 1327
2 SASI_Rn02_00204728 predicted 1008
3 SASI_Rn01_00074357 predicted 1615
4 SASI_Rn01_00074359 predicted 1748
5 SASI_Rn01_00074360 predicted 1850
6 SASI_Rn02_00204729 predicted 1035
7 SASI_Rn01_00074361 predicted 1777
8 SASI_Rn01_00074362 predicted 1820
9 SASI_Rn01_00074363 predicted 1093
10 SASI_Rn01_00074364 predicted 1326
11 SASI_Rn01_00074358 predicted 1564
12 SASI_Rn01_00074365 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309419 predicted 650
2 SASI_Mm02_00309420 predicted 1187
3 SASI_Mm02_00309421 predicted 1325
4 SASI_Mm02_00309422 predicted 648
5 SASI_Mm02_00309423 predicted 1206
6 SASI_Mm02_00309424 predicted 1507
7 SASI_Mm02_00309425 predicted 963
8 SASI_Mm02_00309426 predicted 1198
9 SASI_Mm02_00309427 predicted 1034
10 SASI_Mm02_00309428 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335652 predicted 665
2 SASI_Mm02_00335653 predicted 1200
3 SASI_Mm02_00335654 predicted 1335
4 SASI_Mm02_00335655 predicted 658
5 SASI_Mm02_00335656 predicted 1221
6 SASI_Mm02_00335657 predicted 1516
7 SASI_Mm02_00335658 predicted 969
8 SASI_Mm02_00335659 predicted 1206
9 SASI_Mm02_00335660 predicted 1041
10 SASI_Mm02_00335661 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349960 predicted 659
2 SASI_Mm01_00193594 predicted 1206
3 SASI_Mm01_00193596 predicted 1341
4 SASI_Mm01_00193598 predicted 658
5 SASI_Mm01_00193599 predicted 1221
6 SASI_Mm02_00349961 predicted 1515
7 SASI_Mm02_00349962 predicted 975
8 SASI_Mm02_00349963 predicted 1202
9 SASI_Mm02_00349964 predicted 1046
10 SASI_Mm02_00349965 predicted 1334
11 SASI_Mm01_00193590 predicted 711
12 SASI_Mm01_00193591 predicted 2027
13 SASI_Mm01_00193592 predicted 1811
14 SASI_Mm01_00193593 predicted 1843
15 SASI_Mm01_00193595 predicted 1878
16 SASI_Mm01_00193597 predicted 1156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182782
VALIDATED
KLHL25 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182782.1-2039s1c1
Sequence:CCGGGCATCAGGGTAATGGGATTTACTCGAGTAAATCCCATTACCCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-1523s1c1
Sequence:CCGGCACCGAGATATGGTGTCCAAACTCGAGTTTGGACACCATATCTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-817s1c1
Sequence:CCGGGCATGACTTAGAGCAGAGGAACTCGAGTTCCTCTGCTCTAAGTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-1763s1c1
Sequence:CCGGGCTTCAGGCAACAAGCTGTATCTCGAGATACAGCTTGTTGCCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-364s1c1
Sequence:CCGGCCGATACTTTGAGGCCATGTTCTCGAGAACATGGCCTCAAAGTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182782
VALIDATED
KLHL25 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182782.1-2039s1c1
Sequence:CCGGGCATCAGGGTAATGGGATTTACTCGAGTAAATCCCATTACCCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-1523s1c1
Sequence:CCGGCACCGAGATATGGTGTCCAAACTCGAGTTTGGACACCATATCTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-817s1c1
Sequence:CCGGGCATGACTTAGAGCAGAGGAACTCGAGTTCCTCTGCTCTAAGTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-1763s1c1
Sequence:CCGGGCTTCAGGCAACAAGCTGTATCTCGAGATACAGCTTGTTGCCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-364s1c1
Sequence:CCGGCCGATACTTTGAGGCCATGTTCTCGAGAACATGGCCTCAAAGTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182782
VALIDATED
KLHL25 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182782.1-2039s1c1
Sequence:CCGGGCATCAGGGTAATGGGATTTACTCGAGTAAATCCCATTACCCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-1523s1c1
Sequence:CCGGCACCGAGATATGGTGTCCAAACTCGAGTTTGGACACCATATCTCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-817s1c1
Sequence:CCGGGCATGACTTAGAGCAGAGGAACTCGAGTTCCTCTGCTCTAAGTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-1763s1c1
Sequence:CCGGGCTTCAGGCAACAAGCTGTATCTCGAGATACAGCTTGTTGCCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182782.1-364s1c1
Sequence:CCGGCCGATACTTTGAGGCCATGTTCTCGAGAACATGGCCTCAAAGTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022480
KLHL25 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 25
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022480.2-1822s1c1
Sequence:CCGGCACAGTGCCCTACTCACTTATCTCGAGATAAGTGAGTAGGGCACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022480.2-1768s1c1
Sequence:CCGGGTGTAAGACTCTGGACTGCTACTCGAGTAGCAGTCCAGAGTCTTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1439s1c1
Sequence:CCGGGCCAAGCTGAAGCTCTTTGTTCTCGAGAACAAAGAGCTTCAGCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022480.2-2920s1c1
Sequence:CCGGCCGAGAGAACTGCTGAACATTCTCGAGAATGTTCAGCAGTTCTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1021s1c1
Sequence:CCGGCCAGACCTTCATGTGTGACAACTCGAGTTGTCACACATGAAGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1344s1c1
Sequence:CCGGCCCTGAAACAAGTGGAGAAATCTCGAGATTTCTCCACTTGTTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022480.2-2921s1c1
Sequence:CCGGCGAGAGAACTGCTGAACATTTCTCGAGAAATGTTCAGCAGTTCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1794s1c1
Sequence:CCGGCCACTTCAGATACATGGAACTCTCGAGAGTTCCATGTATCTGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1024s1c1
Sequence:CCGGGACCTTCATGTGTGACAAGATCTCGAGATCTTGTCACACATGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022480.2-2044s1c1
Sequence:CCGGGCTTTAGGCAAGAGAAGAGAACTCGAGTTCTCTTCTCTTGCCTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1345s1c1
Sequence:CCGGCCTGAAACAAGTGGAGAAATACTCGAGTATTTCTCCACTTGTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022480
KLHL25 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 25
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022480.2-1822s1c1
Sequence:CCGGCACAGTGCCCTACTCACTTATCTCGAGATAAGTGAGTAGGGCACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022480.2-1768s1c1
Sequence:CCGGGTGTAAGACTCTGGACTGCTACTCGAGTAGCAGTCCAGAGTCTTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1439s1c1
Sequence:CCGGGCCAAGCTGAAGCTCTTTGTTCTCGAGAACAAAGAGCTTCAGCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022480.2-2920s1c1
Sequence:CCGGCCGAGAGAACTGCTGAACATTCTCGAGAATGTTCAGCAGTTCTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1021s1c1
Sequence:CCGGCCAGACCTTCATGTGTGACAACTCGAGTTGTCACACATGAAGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1344s1c1
Sequence:CCGGCCCTGAAACAAGTGGAGAAATCTCGAGATTTCTCCACTTGTTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022480.2-2921s1c1
Sequence:CCGGCGAGAGAACTGCTGAACATTTCTCGAGAAATGTTCAGCAGTTCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1794s1c1
Sequence:CCGGCCACTTCAGATACATGGAACTCTCGAGAGTTCCATGTATCTGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1024s1c1
Sequence:CCGGGACCTTCATGTGTGACAAGATCTCGAGATCTTGTCACACATGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022480.2-2044s1c1
Sequence:CCGGGCTTTAGGCAAGAGAAGAGAACTCGAGTTCTCTTCTCTTGCCTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1345s1c1
Sequence:CCGGCCTGAAACAAGTGGAGAAATACTCGAGTATTTCTCCACTTGTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022480
KLHL25 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 25
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022480.2-1822s1c1
Sequence:CCGGCACAGTGCCCTACTCACTTATCTCGAGATAAGTGAGTAGGGCACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022480.2-1768s1c1
Sequence:CCGGGTGTAAGACTCTGGACTGCTACTCGAGTAGCAGTCCAGAGTCTTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1439s1c1
Sequence:CCGGGCCAAGCTGAAGCTCTTTGTTCTCGAGAACAAAGAGCTTCAGCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022480.2-2920s1c1
Sequence:CCGGCCGAGAGAACTGCTGAACATTCTCGAGAATGTTCAGCAGTTCTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1021s1c1
Sequence:CCGGCCAGACCTTCATGTGTGACAACTCGAGTTGTCACACATGAAGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1344s1c1
Sequence:CCGGCCCTGAAACAAGTGGAGAAATCTCGAGATTTCTCCACTTGTTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022480.2-2921s1c1
Sequence:CCGGCGAGAGAACTGCTGAACATTTCTCGAGAAATGTTCAGCAGTTCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1794s1c1
Sequence:CCGGCCACTTCAGATACATGGAACTCTCGAGAGTTCCATGTATCTGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1024s1c1
Sequence:CCGGGACCTTCATGTGTGACAAGATCTCGAGATCTTGTCACACATGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022480.2-2044s1c1
Sequence:CCGGGCTTTAGGCAAGAGAAGAGAACTCGAGTTCTCTTCTCTTGCCTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022480.2-1345s1c1
Sequence:CCGGCCTGAAACAAGTGGAGAAATACTCGAGTATTTCTCCACTTGTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)