EMAIL THIS PAGE TO A FRIEND

KLHL26

kelch-like family member 26

78 Gene Product Result for
UniProtKB ID: Q53HC5, Q8TAP0, Q9NUX3
Gene ID:
Mouse(234378) kelch-like 26
Rat(290657) kelch-like family member 26
domestic guinea pig(100713072) kelch-like family member 26
naked mole-rat(101701866) kelch-like family member 26
sheep(101108387) kelch-like 26 (Drosophila)
Zebrafish(558035) kelch-like 26 (Drosophila)
dog(484817) kelch-like 26 (Drosophila)
cow(527458) kelch-like family member 26
Horse(100071045) kelch-like 26 (Drosophila)
domestic cat(101088557) kelch-like 26 (Drosophila)
chicken(420121) kelch-like 26 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001122830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001122830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001122830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018316 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018316 Rosetta Predictions human pricing
NM_001106075 Rosetta Predictions rat pricing
NM_001122830 Rosetta Predictions mouse pricing
NM_172052 Rosetta Predictions mouse pricing
NM_178771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143460 predicted 1927
2 SASI_Hs01_00143461 predicted 2080
3 SASI_Hs01_00143462 predicted 2348
4 SASI_Hs01_00143463 predicted 1062
5 SASI_Hs01_00143464 predicted 2254
6 SASI_Hs02_00351738 predicted 1227
7 SASI_Hs01_00143465 predicted 1423
8 SASI_Hs01_00143466 predicted 380
9 SASI_Hs01_00143468 predicted 1747
10 SASI_Hs02_00351739 predicted 1427
11 SASI_Hs01_00143467 predicted 1491
12 SASI_Hs01_00143469 predicted 2246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215382 predicted 293
2 SASI_Rn02_00215383 predicted 1360
3 SASI_Rn02_00215384 predicted 1755
4 SASI_Rn02_00215385 predicted 609
5 SASI_Rn02_00215386 predicted 1614
6 SASI_Rn02_00215387 predicted 574
7 SASI_Rn02_00215388 predicted 1976
8 SASI_Rn02_00215389 predicted 255
9 SASI_Rn02_00215390 predicted 1773
10 SASI_Rn02_00215391 predicted 1429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309469 predicted 349
2 SASI_Mm02_00309470 predicted 1922
3 SASI_Mm02_00309471 predicted 2050
4 SASI_Mm02_00309472 predicted 1203
5 SASI_Mm02_00309473 predicted 811
6 SASI_Mm02_00309474 predicted 1832
7 SASI_Mm02_00309475 predicted 1950
8 SASI_Mm02_00309476 predicted 1519
9 SASI_Mm02_00309477 predicted 1538
10 SASI_Mm02_00309478 predicted 2045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162757 predicted 537
2 SASI_Mm01_00162758 predicted 1554
3 SASI_Mm01_00162759 predicted 672
4 SASI_Mm01_00162760 predicted 1540
5 SASI_Mm01_00162761 predicted 645
6 SASI_Mm01_00162762 predicted 663
7 SASI_Mm01_00162763 predicted 539
8 SASI_Mm01_00162764 predicted 581
9 SASI_Mm01_00162765 predicted 580
10 SASI_Mm01_00162766 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349338 predicted 535
2 SASI_Mm02_00349339 predicted 2104
3 SASI_Mm02_00349340 predicted 2230
4 SASI_Mm02_00349341 predicted 1386
5 SASI_Mm02_00349342 predicted 1000
6 SASI_Mm02_00349343 predicted 2006
7 SASI_Mm02_00349344 predicted 2135
8 SASI_Mm02_00349345 predicted 1707
9 SASI_Mm02_00349346 predicted 1725
10 SASI_Mm02_00349347 predicted 2222
11 SASI_Mm01_00125017 predicted 624
12 SASI_Mm01_00125018 predicted 1648
13 SASI_Mm01_00125019 predicted 766
14 SASI_Mm01_00125020 predicted 1624
15 SASI_Mm01_00125021 predicted 741
16 SASI_Mm01_00125022 predicted 756
17 SASI_Mm01_00125023 predicted 633
18 SASI_Mm01_00125024 predicted 663
19 SASI_Mm01_00125025 predicted 673
20 SASI_Mm01_00125026 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001122830
VALIDATED
KLHL26 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122830.1-982s21c1
Sequence:CCGGGCTATGATCCACAGCGCAATCCTCGAGGATTGCGCTGTGGATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122830.1-1212s21c1
Sequence:CCGGCTCTACATCTCAGGTGGTTATCTCGAGATAACCACCTGAGATGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122830.1-2039s21c1
Sequence:CCGGCATGCACGCACACAATCAAATCTCGAGATTTGATTGTGTGCGTGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001122830.1-167s21c1
Sequence:CCGGCCTGCGTCACATCATCGATTTCTCGAGAAATCGATGATGTGACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122830.1-1528s21c1
Sequence:CCGGACAACTGGAGGCTGAACAATGCTCGAGCATTGTTCAGCCTCCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001122830
VALIDATED
KLHL26 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122830.1-982s21c1
Sequence:CCGGGCTATGATCCACAGCGCAATCCTCGAGGATTGCGCTGTGGATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122830.1-1212s21c1
Sequence:CCGGCTCTACATCTCAGGTGGTTATCTCGAGATAACCACCTGAGATGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122830.1-2039s21c1
Sequence:CCGGCATGCACGCACACAATCAAATCTCGAGATTTGATTGTGTGCGTGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001122830.1-167s21c1
Sequence:CCGGCCTGCGTCACATCATCGATTTCTCGAGAAATCGATGATGTGACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122830.1-1528s21c1
Sequence:CCGGACAACTGGAGGCTGAACAATGCTCGAGCATTGTTCAGCCTCCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001122830
VALIDATED
KLHL26 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122830.1-982s21c1
Sequence:CCGGGCTATGATCCACAGCGCAATCCTCGAGGATTGCGCTGTGGATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122830.1-1212s21c1
Sequence:CCGGCTCTACATCTCAGGTGGTTATCTCGAGATAACCACCTGAGATGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122830.1-2039s21c1
Sequence:CCGGCATGCACGCACACAATCAAATCTCGAGATTTGATTGTGTGCGTGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001122830.1-167s21c1
Sequence:CCGGCCTGCGTCACATCATCGATTTCTCGAGAAATCGATGATGTGACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122830.1-1528s21c1
Sequence:CCGGACAACTGGAGGCTGAACAATGCTCGAGCATTGTTCAGCCTCCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172052
KLHL26 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 26
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000217040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172052.1-1591s1c1
Sequence:CCGGCTAGAGAGGAAGATCTACATCCTCGAGGATGTAGATCTTCCTCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172052.1-1632s1c1
Sequence:CCGGGCTGAACAATGTCACAGGCATCTCGAGATGCCTGTGACATTGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172052.1-229s1c1
Sequence:CCGGGTCAACAGTGAAGCCTTTCATCTCGAGATGAAAGGCTTCACTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172052.1-2083s1c1
Sequence:CCGGGCAGAGAGACTCTTCAGAATACTCGAGTATTCTGAAGAGTCTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172052
KLHL26 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 26
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000217040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172052.1-1591s1c1
Sequence:CCGGCTAGAGAGGAAGATCTACATCCTCGAGGATGTAGATCTTCCTCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172052.1-1632s1c1
Sequence:CCGGGCTGAACAATGTCACAGGCATCTCGAGATGCCTGTGACATTGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172052.1-229s1c1
Sequence:CCGGGTCAACAGTGAAGCCTTTCATCTCGAGATGAAAGGCTTCACTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172052.1-2083s1c1
Sequence:CCGGGCAGAGAGACTCTTCAGAATACTCGAGTATTCTGAAGAGTCTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172052
KLHL26 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 26
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000217040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172052.1-1591s1c1
Sequence:CCGGCTAGAGAGGAAGATCTACATCCTCGAGGATGTAGATCTTCCTCTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172052.1-1632s1c1
Sequence:CCGGGCTGAACAATGTCACAGGCATCTCGAGATGCCTGTGACATTGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172052.1-229s1c1
Sequence:CCGGGTCAACAGTGAAGCCTTTCATCTCGAGATGAAAGGCTTCACTGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172052.1-2083s1c1
Sequence:CCGGGCAGAGAGACTCTTCAGAATACTCGAGTATTCTGAAGAGTCTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018316
KLHL26 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 26
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-214s1c1
Sequence:CCGGCTCGATGTTGTGCTGACTATTCTCGAGAATAGTCAGCACAACATCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-216s1c1
Sequence:CCGGCGATGTTGTGCTGACTATTAACTCGAGTTAATAGTCAGCACAACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-228s1c1
Sequence:CCGGGACTATTAACAGAGAGGCCTTCTCGAGAAGGCCTCTCTGTTAATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2263s1c1
Sequence:CCGGGCTCATCAACATTGAACCCAACTCGAGTTGGGTTCAATGTTGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2692s1c1
Sequence:CCGGCGCTAACTTCAGAATCCCATACTCGAGTATGGGATTCTGAAGTTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2948s1c1
Sequence:CCGGGCTGTCTCATAGATGGGATTTCTCGAGAAATCCCATCTATGAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-1754s1c1
Sequence:CCGGGCATCGTACAGGTGTACAACACTCGAGTGTTGTACACCTGTACGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2276s1c1
Sequence:CCGGGAACCCAAAGTCGGTGGTATACTCGAGTATACCACCGACTTTGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-1695s1c1
Sequence:CCGGGCTGGAGAGGAAGATCTACATCTCGAGATGTAGATCTTCCTCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2549s1c1
Sequence:CCGGCAACTCCTAGAAACGCTCCTTCTCGAGAAGGAGCGTTTCTAGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-213s1c1
Sequence:CCGGCCTCGATGTTGTGCTGACTATCTCGAGATAGTCAGCACAACATCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018316
KLHL26 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 26
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-214s1c1
Sequence:CCGGCTCGATGTTGTGCTGACTATTCTCGAGAATAGTCAGCACAACATCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-216s1c1
Sequence:CCGGCGATGTTGTGCTGACTATTAACTCGAGTTAATAGTCAGCACAACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-228s1c1
Sequence:CCGGGACTATTAACAGAGAGGCCTTCTCGAGAAGGCCTCTCTGTTAATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2263s1c1
Sequence:CCGGGCTCATCAACATTGAACCCAACTCGAGTTGGGTTCAATGTTGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2692s1c1
Sequence:CCGGCGCTAACTTCAGAATCCCATACTCGAGTATGGGATTCTGAAGTTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2948s1c1
Sequence:CCGGGCTGTCTCATAGATGGGATTTCTCGAGAAATCCCATCTATGAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-1754s1c1
Sequence:CCGGGCATCGTACAGGTGTACAACACTCGAGTGTTGTACACCTGTACGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2276s1c1
Sequence:CCGGGAACCCAAAGTCGGTGGTATACTCGAGTATACCACCGACTTTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-1695s1c1
Sequence:CCGGGCTGGAGAGGAAGATCTACATCTCGAGATGTAGATCTTCCTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2549s1c1
Sequence:CCGGCAACTCCTAGAAACGCTCCTTCTCGAGAAGGAGCGTTTCTAGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-213s1c1
Sequence:CCGGCCTCGATGTTGTGCTGACTATCTCGAGATAGTCAGCACAACATCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018316
KLHL26 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 26
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-214s1c1
Sequence:CCGGCTCGATGTTGTGCTGACTATTCTCGAGAATAGTCAGCACAACATCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-216s1c1
Sequence:CCGGCGATGTTGTGCTGACTATTAACTCGAGTTAATAGTCAGCACAACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-228s1c1
Sequence:CCGGGACTATTAACAGAGAGGCCTTCTCGAGAAGGCCTCTCTGTTAATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2263s1c1
Sequence:CCGGGCTCATCAACATTGAACCCAACTCGAGTTGGGTTCAATGTTGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2692s1c1
Sequence:CCGGCGCTAACTTCAGAATCCCATACTCGAGTATGGGATTCTGAAGTTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2948s1c1
Sequence:CCGGGCTGTCTCATAGATGGGATTTCTCGAGAAATCCCATCTATGAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-1754s1c1
Sequence:CCGGGCATCGTACAGGTGTACAACACTCGAGTGTTGTACACCTGTACGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2276s1c1
Sequence:CCGGGAACCCAAAGTCGGTGGTATACTCGAGTATACCACCGACTTTGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-1695s1c1
Sequence:CCGGGCTGGAGAGGAAGATCTACATCTCGAGATGTAGATCTTCCTCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018316.1-2549s1c1
Sequence:CCGGCAACTCCTAGAAACGCTCCTTCTCGAGAAGGAGCGTTTCTAGGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018316.1-213s1c1
Sequence:CCGGCCTCGATGTTGTGCTGACTATCTCGAGATAGTCAGCACAACATCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)