EMAIL THIS PAGE TO A FRIEND

KLHL28

kelch-like family member 28

210 Gene Product Result for
Synonyms: BTBD5
UniProtKB ID: Q9NXS3, Q0VAL5
Gene ID:
Mouse(66689) kelch-like 28
Rat(299103) kelch-like family member 28
Zebrafish(100333404) kelch-like 28 (Drosophila)
cow(525011) kelch-like 28 (Drosophila)
Horse(100063556) kelch-like 28 (Drosophila)
domestic cat(101088758) kelch-like 28 (Drosophila)
dog(490668) kelch-like 28 (Drosophila)
chicken(423596) kelch-like 28 (Drosophila)
sheep(101105190) kelch-like 28 (Drosophila)
domestic guinea pig(100713474) kelch-like family member 28
naked mole-rat(101717902) kelch-like family member 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017658 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017658 Rosetta Predictions human pricing
NM_001106735 Rosetta Predictions rat pricing
NM_025707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037309 predicted 1130
2 SASI_Hs02_00350371 predicted 199
3 SASI_Hs01_00037311 predicted 391
4 SASI_Hs01_00037312 predicted 1272
5 SASI_Hs01_00037313 predicted 1737
6 SASI_Hs01_00037314 predicted 1409
7 SASI_Hs02_00350372 predicted 456
8 SASI_Hs01_00037315 predicted 521
9 SASI_Hs02_00350373 predicted 1551
10 SASI_Hs02_00350374 predicted 1005
11 SASI_Hs01_00037310 predicted 773
12 SASI_Hs01_00037316 predicted 712
13 SASI_Hs01_00037317 predicted 1274
14 SASI_Hs01_00037318 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221878 predicted 1694
2 SASI_Rn02_00221879 predicted 510
3 SASI_Rn02_00221880 predicted 1301
4 SASI_Rn02_00221881 predicted 592
5 SASI_Rn02_00221882 predicted 492
6 SASI_Rn02_00221883 predicted 487
7 SASI_Rn02_00221884 predicted 1518
8 SASI_Rn02_00221885 predicted 1583
9 SASI_Rn02_00221886 predicted 831
10 SASI_Rn02_00221887 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328877 predicted 800
2 SASI_Mm02_00328878 predicted 910
3 SASI_Mm02_00328879 predicted 720
4 SASI_Mm02_00328880 predicted 514
5 SASI_Mm02_00328881 predicted 588
6 SASI_Mm02_00328882 predicted 1736
7 SASI_Mm02_00328883 predicted 1515
8 SASI_Mm02_00328884 predicted 396
9 SASI_Mm02_00328885 predicted 1691
10 SASI_Mm02_00328886 predicted 1579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017658
KLHL28 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 28
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017658.3-1688s21c1
Sequence:CCGGTGGTGCTGCTGTAATCGATAACTCGAGTTATCGATTACAGCAGCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017658.3-1479s21c1
Sequence:CCGGGAGCGTTATGATCCAAGTAAGCTCGAGCTTACTTGGATCATAACGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017658.2-1858s1c1
Sequence:CCGGGTACTGCATGAACATCCGGATCTCGAGATCCGGATGTTCATGCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-286s1c1
Sequence:CCGGGCTATGTTCACTGGAAACCTTCTCGAGAAGGTTTCCAGTGAACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1060s1c1
Sequence:CCGGCCTCGCTATGAATTTGGAATACTCGAGTATTCCAAATTCATAGCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1631s1c1
Sequence:CCGGGACCAATGAAAGAACCTAGAACTCGAGTTCTAGGTTCTTTCATTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017658.2-1819s1c1
Sequence:CCGGCAAATGTGAACTCTCGGAAATCTCGAGATTTCCGAGAGTTCACATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1175s1c1
Sequence:CCGGGCTGGAATCCTGATACAAATACTCGAGTATTTGTATCAGGATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-270s1c1
Sequence:CCGGCAGCCCGTATTTCAAAGCTATCTCGAGATAGCTTTGAAATACGGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1776s1c1
Sequence:CCGGCATGATATACTGTCGCTGCAACTCGAGTTGCAGCGACAGTATATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017658
KLHL28 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 28
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017658.3-1688s21c1
Sequence:CCGGTGGTGCTGCTGTAATCGATAACTCGAGTTATCGATTACAGCAGCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017658.3-1479s21c1
Sequence:CCGGGAGCGTTATGATCCAAGTAAGCTCGAGCTTACTTGGATCATAACGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017658.2-1858s1c1
Sequence:CCGGGTACTGCATGAACATCCGGATCTCGAGATCCGGATGTTCATGCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-286s1c1
Sequence:CCGGGCTATGTTCACTGGAAACCTTCTCGAGAAGGTTTCCAGTGAACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1060s1c1
Sequence:CCGGCCTCGCTATGAATTTGGAATACTCGAGTATTCCAAATTCATAGCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1631s1c1
Sequence:CCGGGACCAATGAAAGAACCTAGAACTCGAGTTCTAGGTTCTTTCATTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017658.2-1819s1c1
Sequence:CCGGCAAATGTGAACTCTCGGAAATCTCGAGATTTCCGAGAGTTCACATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1175s1c1
Sequence:CCGGGCTGGAATCCTGATACAAATACTCGAGTATTTGTATCAGGATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-270s1c1
Sequence:CCGGCAGCCCGTATTTCAAAGCTATCTCGAGATAGCTTTGAAATACGGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1776s1c1
Sequence:CCGGCATGATATACTGTCGCTGCAACTCGAGTTGCAGCGACAGTATATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017658
KLHL28 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 28
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017658.3-1688s21c1
Sequence:CCGGTGGTGCTGCTGTAATCGATAACTCGAGTTATCGATTACAGCAGCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017658.3-1479s21c1
Sequence:CCGGGAGCGTTATGATCCAAGTAAGCTCGAGCTTACTTGGATCATAACGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017658.2-1858s1c1
Sequence:CCGGGTACTGCATGAACATCCGGATCTCGAGATCCGGATGTTCATGCAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-286s1c1
Sequence:CCGGGCTATGTTCACTGGAAACCTTCTCGAGAAGGTTTCCAGTGAACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1060s1c1
Sequence:CCGGCCTCGCTATGAATTTGGAATACTCGAGTATTCCAAATTCATAGCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1631s1c1
Sequence:CCGGGACCAATGAAAGAACCTAGAACTCGAGTTCTAGGTTCTTTCATTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017658.2-1819s1c1
Sequence:CCGGCAAATGTGAACTCTCGGAAATCTCGAGATTTCCGAGAGTTCACATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1175s1c1
Sequence:CCGGGCTGGAATCCTGATACAAATACTCGAGTATTTGTATCAGGATTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-270s1c1
Sequence:CCGGCAGCCCGTATTTCAAAGCTATCTCGAGATAGCTTTGAAATACGGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017658.2-1776s1c1
Sequence:CCGGCATGATATACTGTCGCTGCAACTCGAGTTGCAGCGACAGTATATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025707
VALIDATED
KLHL28 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 28
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025707.1-156s1c1
Sequence:CCGGGCTTGCTAACTTAACCCACTTCTCGAGAAGTGGGTTAAGTTAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025707.1-314s1c1
Sequence:CCGGCTATGTTCACTGGCAACCTTTCTCGAGAAAGGTTGCCAGTGAACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025707.1-2590s1c1
Sequence:CCGGGCTTCTGATAGTGGATGTAAACTCGAGTTTACATCCACTATCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-518s21c1
Sequence:CCGGCCAACTTGACCCTGGTAATTGCTCGAGCAATTACCAGGGTCAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-1476s21c1
Sequence:CCGGGAGCGTTACGATCCGAGTAAGCTCGAGCTTACTCGGATCGTAACGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-1790s21c1
Sequence:CCGGGGATTCAGCAGGCATGATATACTCGAGTATATCATGCCTGCTGAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-1973s21c1
Sequence:CCGGGTACTTTGAACTGACTAATAGCTCGAGCTATTAGTCAGTTCAAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-660s21c1
Sequence:CCGGCATGCTGATTTGGACGAAATTCTCGAGAATTTCGTCCAAATCAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025707
VALIDATED
KLHL28 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 28
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025707.1-156s1c1
Sequence:CCGGGCTTGCTAACTTAACCCACTTCTCGAGAAGTGGGTTAAGTTAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025707.1-314s1c1
Sequence:CCGGCTATGTTCACTGGCAACCTTTCTCGAGAAAGGTTGCCAGTGAACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025707.1-2590s1c1
Sequence:CCGGGCTTCTGATAGTGGATGTAAACTCGAGTTTACATCCACTATCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-518s21c1
Sequence:CCGGCCAACTTGACCCTGGTAATTGCTCGAGCAATTACCAGGGTCAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-1476s21c1
Sequence:CCGGGAGCGTTACGATCCGAGTAAGCTCGAGCTTACTCGGATCGTAACGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-1790s21c1
Sequence:CCGGGGATTCAGCAGGCATGATATACTCGAGTATATCATGCCTGCTGAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-1973s21c1
Sequence:CCGGGTACTTTGAACTGACTAATAGCTCGAGCTATTAGTCAGTTCAAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-660s21c1
Sequence:CCGGCATGCTGATTTGGACGAAATTCTCGAGAATTTCGTCCAAATCAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025707
VALIDATED
KLHL28 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 28
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025707.1-156s1c1
Sequence:CCGGGCTTGCTAACTTAACCCACTTCTCGAGAAGTGGGTTAAGTTAGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025707.1-314s1c1
Sequence:CCGGCTATGTTCACTGGCAACCTTTCTCGAGAAAGGTTGCCAGTGAACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025707.1-2590s1c1
Sequence:CCGGGCTTCTGATAGTGGATGTAAACTCGAGTTTACATCCACTATCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-518s21c1
Sequence:CCGGCCAACTTGACCCTGGTAATTGCTCGAGCAATTACCAGGGTCAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-1476s21c1
Sequence:CCGGGAGCGTTACGATCCGAGTAAGCTCGAGCTTACTCGGATCGTAACGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-1790s21c1
Sequence:CCGGGGATTCAGCAGGCATGATATACTCGAGTATATCATGCCTGCTGAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-1973s21c1
Sequence:CCGGGTACTTTGAACTGACTAATAGCTCGAGCTATTAGTCAGTTCAAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025707.3-660s21c1
Sequence:CCGGCATGCTGATTTGGACGAAATTCTCGAGAATTTCGTCCAAATCAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)