EMAIL THIS PAGE TO A FRIEND

KLHL29

kelch-like family member 29

223 Gene Product Result for
Synonyms: KBTBD9
UniProtKB ID: Q96CT2, Q8N388, Q96BF0, Q96PW7
Gene ID:
Mouse(208439) kelch-like 29
Rat(298867) kelch-like family member 29
domestic guinea pig(100729554) kelch-like family member 29
naked mole-rat(101704859) kelch-like family member 29
sheep(101104975) kelch-like 29 (Drosophila)
Zebrafish(100537703) kelch-like 29 (Drosophila)
chicken(770342) kelch-like 29 (Drosophila)
dog(482991) kelch-like 29 (Drosophila)
cow(537141) kelch-like 29 (Drosophila)
domestic cat(101096388) kelch-like 29 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052920 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU168341 MISSION® esiRNA esiRNA targeting mouse Klhl29 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717454 Rosetta Predictions human pricing
XM_001717533 Rosetta Predictions human pricing
XM_496546 Rosetta Predictions human pricing
XM_940375 Rosetta Predictions human pricing
NM_001106713 Rosetta Predictions rat pricing
XM_906219 Rosetta Predictions mouse pricing
XM_978355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00417324 predicted 1847
2 SASI_Hs02_00417325 predicted 2050
3 SASI_Hs02_00417326 predicted 2406
4 SASI_Hs02_00417327 predicted 1845
5 SASI_Hs02_00417328 predicted 2046
6 SASI_Hs02_00417329 predicted 2287
7 SASI_Hs02_00417330 predicted 2041
8 SASI_Hs02_00417331 predicted 1746
9 SASI_Hs02_00417332 predicted 1768
10 SASI_Hs02_00417333 predicted 2635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00417802 predicted 1656
2 SASI_Hs02_00417803 predicted 1263
3 SASI_Hs02_00417804 predicted 2097
4 SASI_Hs02_00417805 predicted 2925
5 SASI_Hs02_00417806 predicted 2181
6 SASI_Hs02_00417807 predicted 2473
7 SASI_Hs02_00417808 predicted 1290
8 SASI_Hs02_00417809 predicted 1718
9 SASI_Hs02_00417810 predicted 1820
10 SASI_Hs02_00417811 predicted 2087
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272855 predicted 1296
2 SASI_Hs01_00272856 predicted 1501
3 SASI_Hs01_00272857 predicted 1850
4 SASI_Hs01_00272858 predicted 1295
5 SASI_Hs01_00272859 predicted 1491
6 SASI_Hs01_00272860 predicted 1735
7 SASI_Hs01_00272861 predicted 1482
8 SASI_Hs01_00272862 predicted 1188
9 SASI_Hs01_00272863 predicted 1217
10 SASI_Hs01_00272864 predicted 2080
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484171 predicted 2166
2 SASI_Hs02_00484172 predicted 1767
3 SASI_Hs02_00484173 predicted 2606
4 SASI_Hs02_00484174 predicted 3435
5 SASI_Hs02_00484175 predicted 2695
6 SASI_Hs02_00484176 predicted 2975
7 SASI_Hs02_00484177 predicted 1799
8 SASI_Hs02_00484178 predicted 2233
9 SASI_Hs02_00484179 predicted 2325
10 SASI_Hs02_00484180 predicted 2594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221658 predicted 1591
2 SASI_Rn02_00221659 predicted 2176
3 SASI_Rn02_00221660 predicted 1191
4 SASI_Rn02_00221661 predicted 2270
5 SASI_Rn02_00221662 predicted 1808
6 SASI_Rn02_00221663 predicted 2194
7 SASI_Rn02_00221664 predicted 2121
8 SASI_Rn02_00221665 predicted 2865
9 SASI_Rn02_00221666 predicted 1110
10 SASI_Rn02_00221667 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275762 predicted 1752
2 SASI_Mm02_00432415 predicted 2917
3 SASI_Mm02_00432416 predicted 2823
4 SASI_Mm01_00275766 predicted 1314
5 SASI_Mm01_00275768 predicted 1589
6 SASI_Mm02_00432417 predicted 2736
7 SASI_Mm02_00432418 predicted 2682
8 SASI_Mm02_00432419 predicted 1116
9 SASI_Mm02_00432420 predicted 2755
10 SASI_Mm02_00432421 predicted 1727
11 SASI_Mm01_00275760 predicted 3405
12 SASI_Mm01_00275761 predicted 2595
13 SASI_Mm01_00275763 predicted 3016
14 SASI_Mm01_00275764 predicted 1100
15 SASI_Mm01_00275765 predicted 952
16 SASI_Mm01_00275767 predicted 3410
17 SASI_Mm01_00275769 predicted 2153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446625 predicted 3394
2 SASI_Mm02_00446626 predicted 2598
3 SASI_Mm02_00446627 predicted 1758
4 SASI_Mm02_00446628 predicted 3009
5 SASI_Mm02_00446629 predicted 1102
6 SASI_Mm02_00446630 predicted 949
7 SASI_Mm02_00446631 predicted 1308
8 SASI_Mm02_00446632 predicted 3403
9 SASI_Mm02_00446633 predicted 1595
10 SASI_Mm02_00446634 predicted 2147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164493
KLHL29 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 29
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-1793s21c1
Sequence:CCGGTTTCAAGGACCTGATTCAAAGCTCGAGCTTTGAATCAGGTCCTTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164493.1-3480s21c1
Sequence:CCGGTGCGCTAACATTTCGAATATTCTCGAGAATATTCGAAATGTTAGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-3319s21c1
Sequence:CCGGGACACGGCTGTGTTGTGATAACTCGAGTTATCACAACACAGCCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-1700s21c1
Sequence:CCGGACGCAGAGCGAAAGCATTTACCTCGAGGTAAATGCTTTCGCTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-2758s21c1
Sequence:CCGGGCCACAATAGTCTCGTCTATGCTCGAGCATAGACGAGACTATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-2838s21c1
Sequence:CCGGAGGTACGACACTATCACTAACCTCGAGGTTAGTGATAGTGTCGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164493
KLHL29 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 29
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-1793s21c1
Sequence:CCGGTTTCAAGGACCTGATTCAAAGCTCGAGCTTTGAATCAGGTCCTTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164493.1-3480s21c1
Sequence:CCGGTGCGCTAACATTTCGAATATTCTCGAGAATATTCGAAATGTTAGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-3319s21c1
Sequence:CCGGGACACGGCTGTGTTGTGATAACTCGAGTTATCACAACACAGCCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-1700s21c1
Sequence:CCGGACGCAGAGCGAAAGCATTTACCTCGAGGTAAATGCTTTCGCTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-2758s21c1
Sequence:CCGGGCCACAATAGTCTCGTCTATGCTCGAGCATAGACGAGACTATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-2838s21c1
Sequence:CCGGAGGTACGACACTATCACTAACCTCGAGGTTAGTGATAGTGTCGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164493
KLHL29 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 29
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-1793s21c1
Sequence:CCGGTTTCAAGGACCTGATTCAAAGCTCGAGCTTTGAATCAGGTCCTTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164493.1-3480s21c1
Sequence:CCGGTGCGCTAACATTTCGAATATTCTCGAGAATATTCGAAATGTTAGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-3319s21c1
Sequence:CCGGGACACGGCTGTGTTGTGATAACTCGAGTTATCACAACACAGCCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-1700s21c1
Sequence:CCGGACGCAGAGCGAAAGCATTTACCTCGAGGTAAATGCTTTCGCTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-2758s21c1
Sequence:CCGGGCCACAATAGTCTCGTCTATGCTCGAGCATAGACGAGACTATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164493.1-2838s21c1
Sequence:CCGGAGGTACGACACTATCACTAACCTCGAGGTTAGTGATAGTGTCGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052920
KLHL29 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 29
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052920.1-3463s21c1
Sequence:CCGGAGAGCAAGCTTGATCCCTAAACTCGAGTTTAGGGATCAAGCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-3093s21c1
Sequence:CCGGACACGGCTGCGTCGTGATAAACTCGAGTTTATCACGACGCAGCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-2693s21c1
Sequence:CCGGGCGGCAAGATCTACGTGTTTGCTCGAGCAAACACGTAGATCTTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-1473s21c1
Sequence:CCGGACGCAGAGCGAAAGCGTTTACCTCGAGGTAAACGCTTTCGCTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-2543s21c1
Sequence:CCGGTCGTCTACGATGGGAAGATTTCTCGAGAAATCTTCCCATCGTAGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052920.1-3405s21c1
Sequence:CCGGGCAATAGAGTTTCACGTATTTCTCGAGAAATACGTGAAACTCTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-1566s21c1
Sequence:CCGGTTTCAAGGACCTGATTCAAAGCTCGAGCTTTGAATCAGGTCCTTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052920
KLHL29 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 29
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052920.1-3463s21c1
Sequence:CCGGAGAGCAAGCTTGATCCCTAAACTCGAGTTTAGGGATCAAGCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-3093s21c1
Sequence:CCGGACACGGCTGCGTCGTGATAAACTCGAGTTTATCACGACGCAGCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-2693s21c1
Sequence:CCGGGCGGCAAGATCTACGTGTTTGCTCGAGCAAACACGTAGATCTTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-1473s21c1
Sequence:CCGGACGCAGAGCGAAAGCGTTTACCTCGAGGTAAACGCTTTCGCTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-2543s21c1
Sequence:CCGGTCGTCTACGATGGGAAGATTTCTCGAGAAATCTTCCCATCGTAGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052920.1-3405s21c1
Sequence:CCGGGCAATAGAGTTTCACGTATTTCTCGAGAAATACGTGAAACTCTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-1566s21c1
Sequence:CCGGTTTCAAGGACCTGATTCAAAGCTCGAGCTTTGAATCAGGTCCTTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052920
KLHL29 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 29
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052920.1-3463s21c1
Sequence:CCGGAGAGCAAGCTTGATCCCTAAACTCGAGTTTAGGGATCAAGCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-3093s21c1
Sequence:CCGGACACGGCTGCGTCGTGATAAACTCGAGTTTATCACGACGCAGCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-2693s21c1
Sequence:CCGGGCGGCAAGATCTACGTGTTTGCTCGAGCAAACACGTAGATCTTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-1473s21c1
Sequence:CCGGACGCAGAGCGAAAGCGTTTACCTCGAGGTAAACGCTTTCGCTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-2543s21c1
Sequence:CCGGTCGTCTACGATGGGAAGATTTCTCGAGAAATCTTCCCATCGTAGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052920.1-3405s21c1
Sequence:CCGGGCAATAGAGTTTCACGTATTTCTCGAGAAATACGTGAAACTCTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052920.1-1566s21c1
Sequence:CCGGTTTCAAGGACCTGATTCAAAGCTCGAGCTTTGAATCAGGTCCTTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)