EMAIL THIS PAGE TO A FRIEND

KLHL2

kelch-like family member 2

120 Gene Product Result for
Synonyms: ABP-KELCH MAV MAYVEN
UniProtKB ID: O95198, A6NCM7, B4DFH7, F5H6M3, Q8N484, Q8TBH5
Gene ID:
Mouse(77113) kelch-like 2, Mayven
Rat(290692) kelch-like family member 2
sheep(101120953) kelch-like 2, Mayven (Drosophila)
domestic guinea pig(100723332) kelch-like family member 2
naked mole-rat(101720289) kelch-like family member 2
chicken(422422) kelch-like 2, Mayven (Drosophila)
dog(475490) kelch-like 2, Mayven (Drosophila)
domestic cat(101097235) kelch-like 2, Mayven (Drosophila)
Horse(100068150) kelch-like 2, Mayven (Drosophila)
cow(533936) kelch-like 2, Mayven (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007246 Rosetta Predictions human pricing
NM_001134504 Rosetta Predictions rat pricing
NM_178633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162030 predicted 369
2 SASI_Hs01_00162031 predicted 1324
3 SASI_Hs01_00162032 predicted 1937
4 SASI_Hs01_00162033 predicted 835
5 SASI_Hs01_00162034 predicted 1851
6 SASI_Hs01_00162035 predicted 941
7 SASI_Hs01_00162036 predicted 769
8 SASI_Hs02_00343267 predicted 1897
9 SASI_Hs01_00162037 predicted 896
10 SASI_Hs01_00162038 predicted 1492
11 SASI_Hs01_00162029 predicted 1747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256529 predicted 213
2 SASI_Rn02_00256530 predicted 970
3 SASI_Rn02_00256531 predicted 1707
4 SASI_Rn02_00256532 predicted 1094
5 SASI_Rn02_00256533 predicted 1853
6 SASI_Rn02_00256534 predicted 409
7 SASI_Rn02_00256535 predicted 1041
8 SASI_Rn02_00256536 predicted 953
9 SASI_Rn02_00256537 predicted 1185
10 SASI_Rn02_00256538 predicted 1842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044626 predicted 1628
2 SASI_Mm01_00044627 predicted 1777
3 SASI_Mm01_00044628 predicted 1859
4 SASI_Mm01_00044629 predicted 819
5 SASI_Mm01_00044630 predicted 1247
6 SASI_Mm01_00044631 predicted 1660
7 SASI_Mm01_00044632 predicted 844
8 SASI_Mm02_00349011 predicted 1489
9 SASI_Mm01_00044634 predicted 970
10 SASI_Mm01_00044635 predicted 764
11 SASI_Mm01_00044633 predicted 1533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007246
VALIDATED
KLHL2 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-517s1c1
Sequence:CCGGCCGAGCAAAGAGAGTTAGAATCTCGAGATTCTAACTCTCTTTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-1619s1c1
Sequence:CCGGCGTCAGTGTCTTAGCACAGTACTCGAGTACTGTGCTAAGACACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-590s1c1
Sequence:CCGGGCAGAAATTCAGGTTACAGAACTCGAGTTCTGTAACCTGAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007246.2-838s1c1
Sequence:CCGGCGAACAAGTGTGCAGCTTAATCTCGAGATTAAGCTGCACACTTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-1049s1c1
Sequence:CCGGGCTTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-590s21c1
Sequence:CCGGGCAGAAATTCAGGTTACAGAACTCGAGTTCTGTAACCTGAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-1049s21c1
Sequence:CCGGGCTTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-838s21c1
Sequence:CCGGCGAACAAGTGTGCAGCTTAATCTCGAGATTAAGCTGCACACTTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-517s21c1
Sequence:CCGGCCGAGCAAAGAGAGTTAGAATCTCGAGATTCTAACTCTCTTTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-1619s21c1
Sequence:CCGGCGTCAGTGTCTTAGCACAGTACTCGAGTACTGTGCTAAGACACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007246
VALIDATED
KLHL2 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-517s1c1
Sequence:CCGGCCGAGCAAAGAGAGTTAGAATCTCGAGATTCTAACTCTCTTTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-1619s1c1
Sequence:CCGGCGTCAGTGTCTTAGCACAGTACTCGAGTACTGTGCTAAGACACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-590s1c1
Sequence:CCGGGCAGAAATTCAGGTTACAGAACTCGAGTTCTGTAACCTGAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007246.2-838s1c1
Sequence:CCGGCGAACAAGTGTGCAGCTTAATCTCGAGATTAAGCTGCACACTTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-1049s1c1
Sequence:CCGGGCTTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-590s21c1
Sequence:CCGGGCAGAAATTCAGGTTACAGAACTCGAGTTCTGTAACCTGAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-1049s21c1
Sequence:CCGGGCTTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-838s21c1
Sequence:CCGGCGAACAAGTGTGCAGCTTAATCTCGAGATTAAGCTGCACACTTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-517s21c1
Sequence:CCGGCCGAGCAAAGAGAGTTAGAATCTCGAGATTCTAACTCTCTTTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-1619s21c1
Sequence:CCGGCGTCAGTGTCTTAGCACAGTACTCGAGTACTGTGCTAAGACACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007246
VALIDATED
KLHL2 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-517s1c1
Sequence:CCGGCCGAGCAAAGAGAGTTAGAATCTCGAGATTCTAACTCTCTTTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-1619s1c1
Sequence:CCGGCGTCAGTGTCTTAGCACAGTACTCGAGTACTGTGCTAAGACACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-590s1c1
Sequence:CCGGGCAGAAATTCAGGTTACAGAACTCGAGTTCTGTAACCTGAATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007246.2-838s1c1
Sequence:CCGGCGAACAAGTGTGCAGCTTAATCTCGAGATTAAGCTGCACACTTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007246.2-1049s1c1
Sequence:CCGGGCTTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-590s21c1
Sequence:CCGGGCAGAAATTCAGGTTACAGAACTCGAGTTCTGTAACCTGAATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-1049s21c1
Sequence:CCGGGCTTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-838s21c1
Sequence:CCGGCGAACAAGTGTGCAGCTTAATCTCGAGATTAAGCTGCACACTTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-517s21c1
Sequence:CCGGCCGAGCAAAGAGAGTTAGAATCTCGAGATTCTAACTCTCTTTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007246.2-1619s21c1
Sequence:CCGGCGTCAGTGTCTTAGCACAGTACTCGAGTACTGTGCTAAGACACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178633
KLHL2 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178633.1-1890s1c1
Sequence:CCGGGCCTCGAATGACTATGGATTACTCGAGTAATCCATAGTCATTCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-434s1c1
Sequence:CCGGCCAGTGATAAACTCACCATTTCTCGAGAAATGGTGAGTTTATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-622s1c1
Sequence:CCGGGCGTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-1432s1c1
Sequence:CCGGGCAGTTAATGGTCTGTTGTATCTCGAGATACAACAGACCATTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-423s1c1
Sequence:CCGGCAGCTTAATCTCCAGTGATAACTCGAGTTATCACTGGAGATTAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-769s21c1
Sequence:CCGGCAGCTTAATCTCCAGTGATAACTCGAGTTATCACTGGAGATTAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-968s21c1
Sequence:CCGGGCGTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-1778s21c1
Sequence:CCGGGCAGTTAATGGTCTGTTGTATCTCGAGATACAACAGACCATTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178633.2-2236s21c1
Sequence:CCGGGCCTCGAATGACTATGGATTACTCGAGTAATCCATAGTCATTCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-780s21c1
Sequence:CCGGCCAGTGATAAACTCACCATTTCTCGAGAAATGGTGAGTTTATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178633
KLHL2 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178633.1-1890s1c1
Sequence:CCGGGCCTCGAATGACTATGGATTACTCGAGTAATCCATAGTCATTCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-434s1c1
Sequence:CCGGCCAGTGATAAACTCACCATTTCTCGAGAAATGGTGAGTTTATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-622s1c1
Sequence:CCGGGCGTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-1432s1c1
Sequence:CCGGGCAGTTAATGGTCTGTTGTATCTCGAGATACAACAGACCATTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-423s1c1
Sequence:CCGGCAGCTTAATCTCCAGTGATAACTCGAGTTATCACTGGAGATTAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-769s21c1
Sequence:CCGGCAGCTTAATCTCCAGTGATAACTCGAGTTATCACTGGAGATTAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-968s21c1
Sequence:CCGGGCGTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-1778s21c1
Sequence:CCGGGCAGTTAATGGTCTGTTGTATCTCGAGATACAACAGACCATTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178633.2-2236s21c1
Sequence:CCGGGCCTCGAATGACTATGGATTACTCGAGTAATCCATAGTCATTCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-780s21c1
Sequence:CCGGCCAGTGATAAACTCACCATTTCTCGAGAAATGGTGAGTTTATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178633
KLHL2 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178633.1-1890s1c1
Sequence:CCGGGCCTCGAATGACTATGGATTACTCGAGTAATCCATAGTCATTCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-434s1c1
Sequence:CCGGCCAGTGATAAACTCACCATTTCTCGAGAAATGGTGAGTTTATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-622s1c1
Sequence:CCGGGCGTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-1432s1c1
Sequence:CCGGGCAGTTAATGGTCTGTTGTATCTCGAGATACAACAGACCATTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178633.1-423s1c1
Sequence:CCGGCAGCTTAATCTCCAGTGATAACTCGAGTTATCACTGGAGATTAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-769s21c1
Sequence:CCGGCAGCTTAATCTCCAGTGATAACTCGAGTTATCACTGGAGATTAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-968s21c1
Sequence:CCGGGCGTGCAAAGATTACCTCATTCTCGAGAATGAGGTAATCTTTGCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-1778s21c1
Sequence:CCGGGCAGTTAATGGTCTGTTGTATCTCGAGATACAACAGACCATTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178633.2-2236s21c1
Sequence:CCGGGCCTCGAATGACTATGGATTACTCGAGTAATCCATAGTCATTCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178633.2-780s21c1
Sequence:CCGGCCAGTGATAAACTCACCATTTCTCGAGAAATGGTGAGTTTATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)