EMAIL THIS PAGE TO A FRIEND

KLHL30-AS1

KLHL30 antisense RNA 1

10 Gene Product Result for
Synonyms: C2orf19
Species: Human KLHL30-AS1(394261)
UniProtKB ID: Q8NEE0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024676 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024676 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037329 predicted 357
2 SASI_Hs01_00037330 predicted 274
3 SASI_Hs01_00037331 predicted 260
4 SASI_Hs01_00037332 predicted 342
5 SASI_Hs01_00037333 predicted 362
6 SASI_Hs01_00037334 predicted 148
7 SASI_Hs01_00037335 predicted 432
8 SASI_Hs01_00037336 predicted 176
9 SASI_Hs01_00037337 predicted 134
10 SASI_Hs01_00037338 predicted 584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024676
KLHL30-AS1 MISSION shRNA Bacterial Glycerol Stock
KLHL30 antisense RNA 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000180719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024676.1-475s1c1
Sequence:CCGGGCCGATGAAGTCATGGGAATACTCGAGTATTCCCATGACTTCATCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024676.1-168s1c1
Sequence:CCGGGCAAAGAATTGCGCAGATCAACTCGAGTTGATCTGCGCAATTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024676.1-1796s1c1
Sequence:CCGGCCAAGCTATGTCATGGTCTATCTCGAGATAGACCATGACATAGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024676
KLHL30-AS1 MISSION shRNA shRNA Plasmid DNA
KLHL30 antisense RNA 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000180719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024676.1-475s1c1
Sequence:CCGGGCCGATGAAGTCATGGGAATACTCGAGTATTCCCATGACTTCATCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024676.1-168s1c1
Sequence:CCGGGCAAAGAATTGCGCAGATCAACTCGAGTTGATCTGCGCAATTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024676.1-1796s1c1
Sequence:CCGGCCAAGCTATGTCATGGTCTATCTCGAGATAGACCATGACATAGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024676
KLHL30-AS1 MISSION shRNA Lentiviral Transduction Particles
KLHL30 antisense RNA 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000180719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024676.1-475s1c1
Sequence:CCGGGCCGATGAAGTCATGGGAATACTCGAGTATTCCCATGACTTCATCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024676.1-168s1c1
Sequence:CCGGGCAAAGAATTGCGCAGATCAACTCGAGTTGATCTGCGCAATTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024676.1-1796s1c1
Sequence:CCGGCCAAGCTATGTCATGGTCTATCTCGAGATAGACCATGACATAGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)