EMAIL THIS PAGE TO A FRIEND

KLHL31

kelch-like family member 31

207 Gene Product Result for
Synonyms: BKLHD6 KBTBD1 KLHL bA345L23.2
UniProtKB ID: Q9H511, A6N9J2, B2RP49
Gene ID:
Mouse(244923) kelch-like 31
Rat(315833) kelch-like family member 31
Zebrafish(407079) kelch-like 31 (Drosophila)
cow(512383) kelch-like 31 (Drosophila)
Horse(100069486) kelch-like 31 (Drosophila)
domestic cat(101086809) kelch-like 31 (Drosophila)
dog(481846) kelch-like 31 (Drosophila)
chicken(421893) kelch-like 31 (Drosophila)
sheep(101114565) kelch-like 31 (Drosophila)
Domestic Rabbit(100342133) kelch-like 31 (Drosophila)
domestic guinea pig(100719309) kelch-like family member 31
naked mole-rat(101719719) kelch-like family member 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44458 Anti-KLHL31 antibody produced in rabbit affinity isolated antibody mouse, human, horse, rabbit, rat, canine, zebrafish
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001003760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003760 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003760 Rosetta Predictions human pricing
NM_001108170 Rosetta Predictions rat pricing
NM_172925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221832 predicted 1134
2 SASI_Hs01_00221833 predicted 848
3 SASI_Hs01_00221834 predicted 726
4 SASI_Hs01_00221836 predicted 1138
5 SASI_Hs01_00221837 predicted 980
6 SASI_Hs01_00221838 predicted 452
7 SASI_Hs01_00221840 predicted 705
8 SASI_Hs01_00221841 predicted 1462
9 SASI_Hs02_00304368 predicted 1318
10 SASI_Hs02_00304369 predicted 971
11 SASI_Hs01_00221835 predicted 1232
12 SASI_Hs01_00221839 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236044 predicted 594
2 SASI_Rn02_00236045 predicted 725
3 SASI_Rn02_00236046 predicted 370
4 SASI_Rn02_00236047 predicted 1311
5 SASI_Rn02_00236048 predicted 929
6 SASI_Rn02_00236049 predicted 1496
7 SASI_Rn02_00236050 predicted 515
8 SASI_Rn02_00236051 predicted 2050
9 SASI_Rn02_00236052 predicted 891
10 SASI_Rn02_00236053 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031604 predicted 798
2 SASI_Mm01_00031605 predicted 601
3 SASI_Mm01_00031606 predicted 1505
4 SASI_Mm01_00031607 predicted 1311
5 SASI_Mm01_00031608 predicted 924
6 SASI_Mm01_00031609 predicted 934
7 SASI_Mm01_00031610 predicted 990
8 SASI_Mm01_00031611 predicted 963
9 SASI_Mm02_00344931 predicted 360
10 SASI_Mm02_00344932 predicted 1278
11 SASI_Mm01_00031603 predicted 335
12 SASI_Mm01_00031612 predicted 730
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172925
KLHL31 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 31
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.1-704s1c1
Sequence:CCGGCCGAACAATTTATGAAGCTTACTCGAGTAAGCTTCATAAATTGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.1-676s1c1
Sequence:CCGGCGGGATAACTTCATCGAATTTCTCGAGAAATTCGATGAAGTTATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.2-234s1c1
Sequence:CCGGGAACTAACAGACACTTCTTATCTCGAGATAAGAAGTGTCTGTTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.2-332s1c1
Sequence:CCGGCAAGTCCTTTGATGTCCATAACTCGAGTTATGGACATCAAAGGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172925
KLHL31 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 31
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.1-704s1c1
Sequence:CCGGCCGAACAATTTATGAAGCTTACTCGAGTAAGCTTCATAAATTGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.1-676s1c1
Sequence:CCGGCGGGATAACTTCATCGAATTTCTCGAGAAATTCGATGAAGTTATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.2-234s1c1
Sequence:CCGGGAACTAACAGACACTTCTTATCTCGAGATAAGAAGTGTCTGTTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.2-332s1c1
Sequence:CCGGCAAGTCCTTTGATGTCCATAACTCGAGTTATGGACATCAAAGGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172925
KLHL31 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 31
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.1-704s1c1
Sequence:CCGGCCGAACAATTTATGAAGCTTACTCGAGTAAGCTTCATAAATTGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.1-676s1c1
Sequence:CCGGCGGGATAACTTCATCGAATTTCTCGAGAAATTCGATGAAGTTATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.2-234s1c1
Sequence:CCGGGAACTAACAGACACTTCTTATCTCGAGATAAGAAGTGTCTGTTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172925.2-332s1c1
Sequence:CCGGCAAGTCCTTTGATGTCCATAACTCGAGTTATGGACATCAAAGGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003760
KLHL31 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 31
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-871s1c1
Sequence:CCGGGCTATGAACTACCACTTGCTTCTCGAGAAGCAAGTGGTAGTTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-793s1c1
Sequence:CCGGGCACAAGACCTGGTCAATTATCTCGAGATAATTGACCAGGTCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-697s1c1
Sequence:CCGGGCATTCCAGATTGCAATGAAACTCGAGTTTCATTGCAATCTGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-143s1c1
Sequence:CCGGCTGAACTAACAGATGCTTCTTCTCGAGAAGAAGCATCTGTTAGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003760.2-822s1c1
Sequence:CCGGCGTACCAAGAATGATGCAAGACTCGAGTCTTGCATCATTCTTGGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-1132s1c1
Sequence:CCGGGCAAGAAATCAAGCCAAGCATCTCGAGATGCTTGGCTTGATTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003760.2-908s1c1
Sequence:CCGGCATTGCAATCTAGGCGAACAACTCGAGTTGTTCGCCTAGATTGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003760.4-414s21c1
Sequence:CCGGGGCTTCATGCAGTGAGTATTTCTCGAGAAATACTCACTGCATGAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003760.4-2065s21c1
Sequence:CCGGACGCAGGAAGAACACGTTATTCTCGAGAATAACGTGTTCTTCCTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003760
KLHL31 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 31
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-871s1c1
Sequence:CCGGGCTATGAACTACCACTTGCTTCTCGAGAAGCAAGTGGTAGTTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-793s1c1
Sequence:CCGGGCACAAGACCTGGTCAATTATCTCGAGATAATTGACCAGGTCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-697s1c1
Sequence:CCGGGCATTCCAGATTGCAATGAAACTCGAGTTTCATTGCAATCTGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-143s1c1
Sequence:CCGGCTGAACTAACAGATGCTTCTTCTCGAGAAGAAGCATCTGTTAGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003760.2-822s1c1
Sequence:CCGGCGTACCAAGAATGATGCAAGACTCGAGTCTTGCATCATTCTTGGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-1132s1c1
Sequence:CCGGGCAAGAAATCAAGCCAAGCATCTCGAGATGCTTGGCTTGATTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003760.2-908s1c1
Sequence:CCGGCATTGCAATCTAGGCGAACAACTCGAGTTGTTCGCCTAGATTGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003760.4-414s21c1
Sequence:CCGGGGCTTCATGCAGTGAGTATTTCTCGAGAAATACTCACTGCATGAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003760.4-2065s21c1
Sequence:CCGGACGCAGGAAGAACACGTTATTCTCGAGAATAACGTGTTCTTCCTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003760
KLHL31 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 31
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-871s1c1
Sequence:CCGGGCTATGAACTACCACTTGCTTCTCGAGAAGCAAGTGGTAGTTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-793s1c1
Sequence:CCGGGCACAAGACCTGGTCAATTATCTCGAGATAATTGACCAGGTCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-697s1c1
Sequence:CCGGGCATTCCAGATTGCAATGAAACTCGAGTTTCATTGCAATCTGGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-143s1c1
Sequence:CCGGCTGAACTAACAGATGCTTCTTCTCGAGAAGAAGCATCTGTTAGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003760.2-822s1c1
Sequence:CCGGCGTACCAAGAATGATGCAAGACTCGAGTCTTGCATCATTCTTGGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003760.2-1132s1c1
Sequence:CCGGGCAAGAAATCAAGCCAAGCATCTCGAGATGCTTGGCTTGATTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003760.2-908s1c1
Sequence:CCGGCATTGCAATCTAGGCGAACAACTCGAGTTGTTCGCCTAGATTGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003760.4-414s21c1
Sequence:CCGGGGCTTCATGCAGTGAGTATTTCTCGAGAAATACTCACTGCATGAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003760.4-2065s21c1
Sequence:CCGGACGCAGGAAGAACACGTTATTCTCGAGAATAACGTGTTCTTCCTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)