EMAIL THIS PAGE TO A FRIEND

KLHL32

kelch-like family member 32

104 Gene Product Result for
Synonyms: BKLHD5 KIAA1900 UG0030H05 dJ21F7.1
UniProtKB ID: Q96NJ5, E1P528, Q5THT0, Q96PY7
Gene ID:
Mouse(212390) kelch-like 32
Rat(313111) kelch-like family member 32
domestic guinea pig(100720606) kelch-like family member 32
naked mole-rat(101719682) kelch-like family member 32
sheep(101105257) kelch-like 32 (Drosophila)
Zebrafish(100009653) kelch-like 32 (Drosophila)
dog(481929) kelch-like 32 (Drosophila)
Horse(100065998) kelch-like 32 (Drosophila)
cow(615481) kelch-like family member 32
domestic cat(101081634) kelch-like 32 (Drosophila)
chicken(421801) kelch-like 32 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052904 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006681 MISSION® esiRNA esiRNA targeting human KLHL32 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052904 Rosetta Predictions human pricing
XM_001055854 Rosetta Predictions rat pricing
XM_001055962 Rosetta Predictions rat pricing
XM_001060760 Rosetta Predictions rat pricing
XM_232840 Rosetta Predictions rat pricing
NM_001033531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232557 predicted 2012
2 SASI_Hs01_00232558 predicted 1394
3 SASI_Hs02_00361652 predicted 672
4 SASI_Hs01_00232560 predicted 1859
5 SASI_Hs02_00361653 predicted 1994
6 SASI_Hs02_00361654 predicted 956
7 SASI_Hs01_00232561 predicted 849
8 SASI_Hs01_00232562 predicted 1603
9 SASI_Hs01_00232563 predicted 1864
10 SASI_Hs01_00232564 predicted 1810
11 SASI_Hs01_00232559 predicted 2267
12 SASI_Hs01_00232565 predicted 1172
13 SASI_Hs01_00232566 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281228 predicted 1848
2 SASI_Rn02_00281229 predicted 1817
3 SASI_Rn02_00281230 predicted 1437
4 SASI_Rn02_00281231 predicted 1585
5 SASI_Rn02_00281232 predicted 1944
6 SASI_Rn02_00281233 predicted 1447
7 SASI_Rn02_00281234 predicted 793
8 SASI_Rn02_00281235 predicted 1522
9 SASI_Rn02_00281236 predicted 964
10 SASI_Rn02_00281237 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281594 predicted 794
2 SASI_Rn02_00281595 predicted 1950
3 SASI_Rn02_00281596 predicted 1915
4 SASI_Rn02_00281597 predicted 1686
5 SASI_Rn02_00281598 predicted 825
6 SASI_Rn02_00281599 predicted 1544
7 SASI_Rn02_00281600 predicted 892
8 SASI_Rn02_00281601 predicted 1623
9 SASI_Rn02_00281602 predicted 1066
10 SASI_Rn02_00281603 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297641 predicted 797
2 SASI_Rn02_00297642 predicted 721
3 SASI_Rn02_00297643 predicted 755
4 SASI_Rn02_00297644 predicted 529
5 SASI_Rn02_00297645 predicted 509
6 SASI_Rn02_00297646 predicted 730
7 SASI_Rn02_00297647 predicted 604
8 SASI_Rn02_00297648 predicted 779
9 SASI_Rn02_00297649 predicted 847
10 SASI_Rn02_00297650 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387285 predicted 1952
2 SASI_Rn02_00387286 predicted 1941
3 SASI_Rn02_00387287 predicted 1913
4 SASI_Rn02_00387288 predicted 2025
5 SASI_Rn02_00387289 predicted 1691
6 SASI_Rn02_00387290 predicted 1550
7 SASI_Rn02_00387291 predicted 1621
8 SASI_Rn02_00387292 predicted 1991
9 SASI_Rn02_00387293 predicted 2003
10 SASI_Rn02_00387294 predicted 1965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175415 predicted 677
2 SASI_Mm01_00175416 predicted 979
3 SASI_Mm01_00175417 predicted 759
4 SASI_Mm01_00175418 predicted 1820
5 SASI_Mm01_00175419 predicted 1808
6 SASI_Mm01_00175420 predicted 1911
7 SASI_Mm01_00175421 predicted 1633
8 SASI_Mm01_00175422 predicted 1410
9 SASI_Mm01_00175423 predicted 1687
10 SASI_Mm01_00175424 predicted 1676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033531
KLHL32 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 32
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1810s21c1
Sequence:CCGGCCGGATTCTCGTGCGTCATATCTCGAGATATGACGCACGAGAATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1144s21c1
Sequence:CCGGGTCCGATACTCTCTATATTATCTCGAGATAATATAGAGAGTATCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1590s21c1
Sequence:CCGGTCTCGTGTCACGCTGGATATGCTCGAGCATATCCAGCGTGACACGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-971s21c1
Sequence:CCGGTACATCCGCTTTGGCCTAATGCTCGAGCATTAGGCCAAAGCGGATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1853s21c1
Sequence:CCGGGATCAGTGGACGCGCTGTAATCTCGAGATTACAGCGCGTCCACTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033531
KLHL32 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 32
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1810s21c1
Sequence:CCGGCCGGATTCTCGTGCGTCATATCTCGAGATATGACGCACGAGAATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1144s21c1
Sequence:CCGGGTCCGATACTCTCTATATTATCTCGAGATAATATAGAGAGTATCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1590s21c1
Sequence:CCGGTCTCGTGTCACGCTGGATATGCTCGAGCATATCCAGCGTGACACGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-971s21c1
Sequence:CCGGTACATCCGCTTTGGCCTAATGCTCGAGCATTAGGCCAAAGCGGATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1853s21c1
Sequence:CCGGGATCAGTGGACGCGCTGTAATCTCGAGATTACAGCGCGTCCACTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033531
KLHL32 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 32
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1810s21c1
Sequence:CCGGCCGGATTCTCGTGCGTCATATCTCGAGATATGACGCACGAGAATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1144s21c1
Sequence:CCGGGTCCGATACTCTCTATATTATCTCGAGATAATATAGAGAGTATCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1590s21c1
Sequence:CCGGTCTCGTGTCACGCTGGATATGCTCGAGCATATCCAGCGTGACACGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-971s21c1
Sequence:CCGGTACATCCGCTTTGGCCTAATGCTCGAGCATTAGGCCAAAGCGGATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033531.2-1853s21c1
Sequence:CCGGGATCAGTGGACGCGCTGTAATCTCGAGATTACAGCGCGTCCACTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052904
KLHL32 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 32
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143709    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052904.1-3088s1c1
Sequence:CCGGGCATGTGAAAGAGACACACAACTCGAGTTGTGTGTCTCTTTCACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-1280s1c1
Sequence:CCGGCGGTACTTCAATCCTGTTGATCTCGAGATCAACAGGATTGAAGTACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-893s1c1
Sequence:CCGGCCAGAAGAAGTTCTAACGCTTCTCGAGAAGCGTTAGAACTTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-500s1c1
Sequence:CCGGGCTGAGGAACAGAAATTCCATCTCGAGATGGAATTTCTGTTCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-1985s1c1
Sequence:CCGGGCTGTCCATAATGGGAGAATACTCGAGTATTCTCCCATTATGGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052904.1-2918s1c1
Sequence:CCGGGCGAACACTTTGTAATACTTTCTCGAGAAAGTATTACAAAGTGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052904.1-2535s1c1
Sequence:CCGGCAACACTGTTAGTAAGGCAATCTCGAGATTGCCTTACTAACAGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052904.1-2301s1c1
Sequence:CCGGGCTTCCTTGTCTTGCTTTATACTCGAGTATAAAGCAAGACAAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-1747s1c1
Sequence:CCGGGCTAATGGTGTATGAACCTAACTCGAGTTAGGTTCATACACCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052904
KLHL32 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 32
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143709    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052904.1-3088s1c1
Sequence:CCGGGCATGTGAAAGAGACACACAACTCGAGTTGTGTGTCTCTTTCACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-1280s1c1
Sequence:CCGGCGGTACTTCAATCCTGTTGATCTCGAGATCAACAGGATTGAAGTACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-893s1c1
Sequence:CCGGCCAGAAGAAGTTCTAACGCTTCTCGAGAAGCGTTAGAACTTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-500s1c1
Sequence:CCGGGCTGAGGAACAGAAATTCCATCTCGAGATGGAATTTCTGTTCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-1985s1c1
Sequence:CCGGGCTGTCCATAATGGGAGAATACTCGAGTATTCTCCCATTATGGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052904.1-2918s1c1
Sequence:CCGGGCGAACACTTTGTAATACTTTCTCGAGAAAGTATTACAAAGTGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052904.1-2535s1c1
Sequence:CCGGCAACACTGTTAGTAAGGCAATCTCGAGATTGCCTTACTAACAGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052904.1-2301s1c1
Sequence:CCGGGCTTCCTTGTCTTGCTTTATACTCGAGTATAAAGCAAGACAAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-1747s1c1
Sequence:CCGGGCTAATGGTGTATGAACCTAACTCGAGTTAGGTTCATACACCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052904
KLHL32 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 32
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143709    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052904.1-3088s1c1
Sequence:CCGGGCATGTGAAAGAGACACACAACTCGAGTTGTGTGTCTCTTTCACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-1280s1c1
Sequence:CCGGCGGTACTTCAATCCTGTTGATCTCGAGATCAACAGGATTGAAGTACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-893s1c1
Sequence:CCGGCCAGAAGAAGTTCTAACGCTTCTCGAGAAGCGTTAGAACTTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-500s1c1
Sequence:CCGGGCTGAGGAACAGAAATTCCATCTCGAGATGGAATTTCTGTTCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-1985s1c1
Sequence:CCGGGCTGTCCATAATGGGAGAATACTCGAGTATTCTCCCATTATGGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052904.1-2918s1c1
Sequence:CCGGGCGAACACTTTGTAATACTTTCTCGAGAAAGTATTACAAAGTGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052904.1-2535s1c1
Sequence:CCGGCAACACTGTTAGTAAGGCAATCTCGAGATTGCCTTACTAACAGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052904.1-2301s1c1
Sequence:CCGGGCTTCCTTGTCTTGCTTTATACTCGAGTATAAAGCAAGACAAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052904.1-1747s1c1
Sequence:CCGGGCTAATGGTGTATGAACCTAACTCGAGTTAGGTTCATACACCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)