EMAIL THIS PAGE TO A FRIEND

KLHL34

kelch-like family member 34

63 Gene Product Result for
UniProtKB ID: Q8N239
Gene ID:
Mouse(245683) kelch-like 34
Rat(302703) kelch-like family member 34
domestic guinea pig(100713352) kelch-like family member 34
naked mole-rat(101725517) kelch-like family member 34
sheep(101106663) kelch-like 34 (Drosophila)
Domestic Rabbit(100340788) kelch-like 34 (Drosophila)
chicken(418604) kelch-like 34 (Drosophila)
cow(519605) kelch-like family member 34
domestic cat(101090591) kelch-like 34 (Drosophila)
dog(491769) kelch-like 34 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU169381 MISSION® esiRNA esiRNA targeting mouse Klhl34 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153270 Rosetta Predictions human pricing
XM_001055437 Rosetta Predictions rat pricing
XM_228962 Rosetta Predictions rat pricing
NM_001081667 Rosetta Predictions mouse pricing
XM_142269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164734 predicted 2213
2 SASI_Hs01_00164735 predicted 2133
3 SASI_Hs01_00164737 predicted 2501
4 SASI_Hs01_00164739 predicted 2527
5 SASI_Hs01_00164740 predicted 2472
6 SASI_Hs01_00164741 predicted 2076
7 SASI_Hs01_00164742 predicted 2139
8 SASI_Hs01_00164743 predicted 1738
9 SASI_Hs02_00367149 predicted 2573
10 SASI_Hs02_00367150 predicted 2436
11 SASI_Hs01_00164736 predicted 697
12 SASI_Hs01_00164738 predicted 2449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279512 predicted 2251
2 SASI_Rn02_00279513 predicted 2025
3 SASI_Rn02_00279514 predicted 2085
4 SASI_Rn02_00279515 predicted 1064
5 SASI_Rn02_00279516 predicted 2095
6 SASI_Rn02_00279517 predicted 734
7 SASI_Rn02_00279518 predicted 1537
8 SASI_Rn02_00279519 predicted 2277
9 SASI_Rn02_00279520 predicted 2121
10 SASI_Rn02_00279521 predicted 1588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385675 predicted 2250
2 SASI_Rn02_00385676 predicted 2018
3 SASI_Rn02_00385677 predicted 2082
4 SASI_Rn02_00385678 predicted 1069
5 SASI_Rn02_00385679 predicted 2098
6 SASI_Rn02_00385680 predicted 735
7 SASI_Rn02_00385681 predicted 1536
8 SASI_Rn02_00385682 predicted 2279
9 SASI_Rn02_00385683 predicted 2120
10 SASI_Rn02_00385684 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298920 predicted 1669
2 SASI_Mm02_00298921 predicted 1598
3 SASI_Mm02_00298922 predicted 1468
4 SASI_Mm02_00298923 predicted 683
5 SASI_Mm02_00298924 predicted 347
6 SASI_Mm02_00298925 predicted 1378
7 SASI_Mm02_00298926 predicted 651
8 SASI_Mm02_00298927 predicted 512
9 SASI_Mm02_00298928 predicted 688
10 SASI_Mm02_00298929 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_142269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207960 predicted 503
2 SASI_Mm01_00207961 predicted 2017
3 SASI_Mm01_00207962 predicted 1951
4 SASI_Mm01_00207963 predicted 1824
5 SASI_Mm01_00207964 predicted 1043
6 SASI_Mm01_00207965 predicted 706
7 SASI_Mm01_00207966 predicted 1735
8 SASI_Mm01_00207967 predicted 1001
9 SASI_Mm01_00207968 predicted 873
10 SASI_Mm01_00207969 predicted 857
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153270
KLHL34 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 34
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153270.1-2475s21c1
Sequence:CCGGTGAATGGGTCAGTCCGGTTTCCTCGAGGAAACCGGACTGACCCATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153270.1-2444s21c1
Sequence:CCGGGGTTGGAGAGGCGCTAGATTTCTCGAGAAATCTAGCGCCTCTCCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2519s1c1
Sequence:CCGGGCGCTTGGTTAGTCTTACAGACTCGAGTCTGTAAGACTAACCAAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2631s1c1
Sequence:CCGGCATTTCTCCTTGAGCTGAGAACTCGAGTTCTCAGCTCAAGGAGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2620s1c1
Sequence:CCGGGCAAAGAGAAACATTTCTCCTCTCGAGAGGAGAAATGTTTCTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153270.1-2516s21c1
Sequence:CCGGGTCGCGCTTGGTTAGTCTTACCTCGAGGTAAGACTAACCAAGCGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2613s1c1
Sequence:CCGGGCCTTGAGCAAAGAGAAACATCTCGAGATGTTTCTCTTTGCTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2681s1c1
Sequence:CCGGGAAGGCTATATGAATCAACTTCTCGAGAAGTTGATTCATATAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2614s1c1
Sequence:CCGGCCTTGAGCAAAGAGAAACATTCTCGAGAATGTTTCTCTTTGCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153270
KLHL34 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 34
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153270.1-2475s21c1
Sequence:CCGGTGAATGGGTCAGTCCGGTTTCCTCGAGGAAACCGGACTGACCCATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153270.1-2444s21c1
Sequence:CCGGGGTTGGAGAGGCGCTAGATTTCTCGAGAAATCTAGCGCCTCTCCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2519s1c1
Sequence:CCGGGCGCTTGGTTAGTCTTACAGACTCGAGTCTGTAAGACTAACCAAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2631s1c1
Sequence:CCGGCATTTCTCCTTGAGCTGAGAACTCGAGTTCTCAGCTCAAGGAGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2620s1c1
Sequence:CCGGGCAAAGAGAAACATTTCTCCTCTCGAGAGGAGAAATGTTTCTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153270.1-2516s21c1
Sequence:CCGGGTCGCGCTTGGTTAGTCTTACCTCGAGGTAAGACTAACCAAGCGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2613s1c1
Sequence:CCGGGCCTTGAGCAAAGAGAAACATCTCGAGATGTTTCTCTTTGCTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2681s1c1
Sequence:CCGGGAAGGCTATATGAATCAACTTCTCGAGAAGTTGATTCATATAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2614s1c1
Sequence:CCGGCCTTGAGCAAAGAGAAACATTCTCGAGAATGTTTCTCTTTGCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153270
KLHL34 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 34
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153270.1-2475s21c1
Sequence:CCGGTGAATGGGTCAGTCCGGTTTCCTCGAGGAAACCGGACTGACCCATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153270.1-2444s21c1
Sequence:CCGGGGTTGGAGAGGCGCTAGATTTCTCGAGAAATCTAGCGCCTCTCCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2519s1c1
Sequence:CCGGGCGCTTGGTTAGTCTTACAGACTCGAGTCTGTAAGACTAACCAAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2631s1c1
Sequence:CCGGCATTTCTCCTTGAGCTGAGAACTCGAGTTCTCAGCTCAAGGAGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2620s1c1
Sequence:CCGGGCAAAGAGAAACATTTCTCCTCTCGAGAGGAGAAATGTTTCTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153270.1-2516s21c1
Sequence:CCGGGTCGCGCTTGGTTAGTCTTACCTCGAGGTAAGACTAACCAAGCGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2613s1c1
Sequence:CCGGGCCTTGAGCAAAGAGAAACATCTCGAGATGTTTCTCTTTGCTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2681s1c1
Sequence:CCGGGAAGGCTATATGAATCAACTTCTCGAGAAGTTGATTCATATAGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153270.1-2614s1c1
Sequence:CCGGCCTTGAGCAAAGAGAAACATTCTCGAGAATGTTTCTCTTTGCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081667
KLHL34 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 34
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-1007s21c1
Sequence:CCGGTGGTGTCCTTCGACGTGTATACTCGAGTATACACGTCGAAGGACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-710s21c1
Sequence:CCGGACTCGGGCTCCGGTCTTATATCTCGAGATATAAGACCGGAGCCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-512s21c1
Sequence:CCGGTGTTGGAACTCAATCCTATATCTCGAGATATAGGATTGAGTTCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-403s21c1
Sequence:CCGGGCCAATGTGGCAGCTCGATTTCTCGAGAAATCGAGCTGCCACATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081667
KLHL34 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 34
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-1007s21c1
Sequence:CCGGTGGTGTCCTTCGACGTGTATACTCGAGTATACACGTCGAAGGACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-710s21c1
Sequence:CCGGACTCGGGCTCCGGTCTTATATCTCGAGATATAAGACCGGAGCCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-512s21c1
Sequence:CCGGTGTTGGAACTCAATCCTATATCTCGAGATATAGGATTGAGTTCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-403s21c1
Sequence:CCGGGCCAATGTGGCAGCTCGATTTCTCGAGAAATCGAGCTGCCACATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081667
KLHL34 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 34
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-1007s21c1
Sequence:CCGGTGGTGTCCTTCGACGTGTATACTCGAGTATACACGTCGAAGGACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-710s21c1
Sequence:CCGGACTCGGGCTCCGGTCTTATATCTCGAGATATAAGACCGGAGCCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-512s21c1
Sequence:CCGGTGTTGGAACTCAATCCTATATCTCGAGATATAGGATTGAGTTCCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081667.1-403s21c1
Sequence:CCGGGCCAATGTGGCAGCTCGATTTCTCGAGAAATCGAGCTGCCACATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)