EMAIL THIS PAGE TO A FRIEND

KLHL35

kelch-like family member 35

77 Gene Product Result for
UniProtKB ID: Q6PF15, A2RU06, Q86XM7, Q8NBB1
Gene ID:
Mouse(72184) kelch-like 35
Rat(308850) kelch-like family member 35
chicken(419071) kelch-like 35 (Drosophila)
cow(539879) kelch-like 35 (Drosophila)
domestic cat(101100832) kelch-like 35 (Drosophila)
dog(609209) kelch-like 35 (Drosophila)
sheep(101106624) kelch-like 35 (Drosophila)
Domestic Rabbit(100355838) kelch-like 35 (Drosophila)
domestic guinea pig(100731525) kelch-like family member 35
naked mole-rat(101702495) kelch-like family member 35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173583 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039548 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_133597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039548 Rosetta Predictions human pricing
XM_218953 Rosetta Predictions rat pricing
XR_008288 Rosetta Predictions rat pricing
XM_133597 Rosetta Predictions mouse pricing
XM_905932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115168 predicted 923
2 SASI_Hs01_00115169 predicted 641
3 SASI_Hs01_00115170 predicted 1134
4 SASI_Hs01_00115171 predicted 1056
5 SASI_Hs01_00115172 predicted 559
6 SASI_Hs01_00115173 predicted 1015
7 SASI_Hs01_00115174 predicted 283
8 SASI_Hs02_00308558 predicted 638
9 SASI_Hs02_00308559 predicted 923
10 SASI_Hs02_00308560 predicted 564
11 SASI_Hs01_00115175 predicted 1000
12 SASI_Hs01_00115176 predicted 1202
13 SASI_Hs01_00115177 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378227 predicted 1496
2 SASI_Rn02_00378228 predicted 1024
3 SASI_Rn02_00378229 predicted 1078
4 SASI_Rn02_00378230 predicted 1107
5 SASI_Rn02_00378231 predicted 1564
6 SASI_Rn02_00378232 predicted 1230
7 SASI_Rn02_00378233 predicted 1143
8 SASI_Rn02_00378234 predicted 874
9 SASI_Rn02_00378235 predicted 1415
10 SASI_Rn02_00378236 predicted 1611
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146584 predicted 1496
2 SASI_Rn01_00146585 predicted 1021
3 SASI_Rn01_00146586 predicted 1073
4 SASI_Rn01_00146587 predicted 1110
5 SASI_Rn01_00146588 predicted 1567
6 SASI_Rn01_00146589 predicted 1225
7 SASI_Rn01_00146592 predicted 1147
8 SASI_Rn02_00416668 predicted 868
9 SASI_Rn01_00146593 predicted 1410
10 SASI_Rn02_00416669 predicted 1616
11 SASI_Rn01_00146590 predicted 311
12 SASI_Rn01_00146591 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424537 predicted 1182
2 SASI_Mm02_00424538 predicted 945
3 SASI_Mm02_00424539 predicted 1434
4 SASI_Mm02_00424540 predicted 1225
5 SASI_Mm02_00424541 predicted 1072
6 SASI_Mm02_00424542 predicted 1128
7 SASI_Mm02_00424543 predicted 980
8 SASI_Mm02_00424544 predicted 1112
9 SASI_Mm02_00424545 predicted 1417
10 SASI_Mm01_00224391 predicted 1706
11 SASI_Mm01_00224387 predicted 1650
12 SASI_Mm01_00224388 predicted 1707
13 SASI_Mm01_00224389 predicted 1723
14 SASI_Mm01_00224390 predicted 1706
15 SASI_Mm01_00224392 predicted 1698
16 SASI_Mm01_00224393 predicted 1656
17 SASI_Mm01_00224394 predicted 1666
18 SASI_Mm01_00224395 predicted 1097
19 SASI_Mm01_00224396 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432224 predicted 1187
2 SASI_Mm02_00432225 predicted 942
3 SASI_Mm02_00432226 predicted 1426
4 SASI_Mm02_00432227 predicted 1225
5 SASI_Mm02_00432228 predicted 1069
6 SASI_Mm02_00432229 predicted 1127
7 SASI_Mm02_00432230 predicted 980
8 SASI_Mm02_00432231 predicted 1121
9 SASI_Mm02_00432232 predicted 619
10 SASI_Mm02_00432233 predicted 1421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173583
KLHL35 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 35
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-547s1c1
Sequence:CCGGGTGTGGATGTTTAGCTCCCATCTCGAGATGGGAGCTAAACATCCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173583.1-859s1c1
Sequence:CCGGCCATAGAGTCTAGGTTTGAATCTCGAGATTCAAACCTAGACTCTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-177s1c1
Sequence:CCGGGCCCGCTTACTTCCTGGAGAACTCGAGTTCTCCAGGAAGTAAGCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-667s1c1
Sequence:CCGGCCTGGGACACAAGGTACAGATCTCGAGATCTGTACCTTGTGTCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-464s1c1
Sequence:CCGGCCGGCTACACTCGCTCAGAATCTCGAGATTCTGAGCGAGTGTAGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173583
KLHL35 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 35
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-547s1c1
Sequence:CCGGGTGTGGATGTTTAGCTCCCATCTCGAGATGGGAGCTAAACATCCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173583.1-859s1c1
Sequence:CCGGCCATAGAGTCTAGGTTTGAATCTCGAGATTCAAACCTAGACTCTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-177s1c1
Sequence:CCGGGCCCGCTTACTTCCTGGAGAACTCGAGTTCTCCAGGAAGTAAGCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-667s1c1
Sequence:CCGGCCTGGGACACAAGGTACAGATCTCGAGATCTGTACCTTGTGTCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-464s1c1
Sequence:CCGGCCGGCTACACTCGCTCAGAATCTCGAGATTCTGAGCGAGTGTAGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173583
KLHL35 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 35
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-547s1c1
Sequence:CCGGGTGTGGATGTTTAGCTCCCATCTCGAGATGGGAGCTAAACATCCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173583.1-859s1c1
Sequence:CCGGCCATAGAGTCTAGGTTTGAATCTCGAGATTCAAACCTAGACTCTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-177s1c1
Sequence:CCGGGCCCGCTTACTTCCTGGAGAACTCGAGTTCTCCAGGAAGTAAGCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-667s1c1
Sequence:CCGGCCTGGGACACAAGGTACAGATCTCGAGATCTGTACCTTGTGTCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173583.1-464s1c1
Sequence:CCGGCCGGCTACACTCGCTCAGAATCTCGAGATTCTGAGCGAGTGTAGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039548
KLHL35 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 35
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000415064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039548.2-1457s21c1
Sequence:CCGGCCCTTGAGGACACCATCTATGCTCGAGCATAGATGGTGTCCTCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039548.2-1507s21c1
Sequence:CCGGACCTATGATCCAGGCACAGATCTCGAGATCTGTGCCTGGATCATAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039548.2-894s21c1
Sequence:CCGGAGCTGAAGTGATCGTGGTCATCTCGAGATGACCACGATCACTTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039548
KLHL35 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 35
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000415064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039548.2-1457s21c1
Sequence:CCGGCCCTTGAGGACACCATCTATGCTCGAGCATAGATGGTGTCCTCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039548.2-1507s21c1
Sequence:CCGGACCTATGATCCAGGCACAGATCTCGAGATCTGTGCCTGGATCATAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039548.2-894s21c1
Sequence:CCGGAGCTGAAGTGATCGTGGTCATCTCGAGATGACCACGATCACTTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039548
KLHL35 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 35
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000415064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039548.2-1457s21c1
Sequence:CCGGCCCTTGAGGACACCATCTATGCTCGAGCATAGATGGTGTCCTCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039548.2-1507s21c1
Sequence:CCGGACCTATGATCCAGGCACAGATCTCGAGATCTGTGCCTGGATCATAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039548.2-894s21c1
Sequence:CCGGAGCTGAAGTGATCGTGGTCATCTCGAGATGACCACGATCACTTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133597
KLHL35 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 35
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1524s21c1
Sequence:CCGGCTCCCTGGAAGACACCATTTACTCGAGTAAATGGTGTCTTCCAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-965s21c1
Sequence:CCGGCTGAAGTGATCGTGGTCATTGCTCGAGCAATGACCACGATCACTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1151s21c1
Sequence:CCGGGCCGTGACGTCTGGATGTTTACTCGAGTAAACATCCAGACGTCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1108s21c1
Sequence:GTACCGGGCACTTCGAAATGACATTTACCTCGAGGTAAATGTCATTTCGAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1388s21c1
Sequence:CCGGCTGGCCAGCTATACGTGATTGCTCGAGCAATCACGTATAGCTGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133597
KLHL35 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 35
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1524s21c1
Sequence:CCGGCTCCCTGGAAGACACCATTTACTCGAGTAAATGGTGTCTTCCAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-965s21c1
Sequence:CCGGCTGAAGTGATCGTGGTCATTGCTCGAGCAATGACCACGATCACTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1151s21c1
Sequence:CCGGGCCGTGACGTCTGGATGTTTACTCGAGTAAACATCCAGACGTCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1108s21c1
Sequence:GTACCGGGCACTTCGAAATGACATTTACCTCGAGGTAAATGTCATTTCGAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1388s21c1
Sequence:CCGGCTGGCCAGCTATACGTGATTGCTCGAGCAATCACGTATAGCTGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133597
KLHL35 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 35
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1524s21c1
Sequence:CCGGCTCCCTGGAAGACACCATTTACTCGAGTAAATGGTGTCTTCCAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-965s21c1
Sequence:CCGGCTGAAGTGATCGTGGTCATTGCTCGAGCAATGACCACGATCACTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1151s21c1
Sequence:CCGGGCCGTGACGTCTGGATGTTTACTCGAGTAAACATCCAGACGTCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1108s21c1
Sequence:GTACCGGGCACTTCGAAATGACATTTACCTCGAGGTAAATGTCATTTCGAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_133597.5-1388s21c1
Sequence:CCGGCTGGCCAGCTATACGTGATTGCTCGAGCAATCACGTATAGCTGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)