EMAIL THIS PAGE TO A FRIEND

KLHL36

kelch-like family member 36

49 Gene Product Result for
Synonyms: C16orf44
UniProtKB ID: Q8N4N3, Q8N5G6, Q9H9U6
Gene ID:
Mouse(234796) kelch-like 36
Rat(498957) kelch-like family member 36
domestic guinea pig(100716766) kelch-like family member 36
naked mole-rat(101726603) kelch-like family member 36
sheep(101103833) kelch-like 36 (Drosophila)
Zebrafish(553604) kelch-like 36 (Drosophila)
chicken(415816) kelch-like 36 (Drosophila)
dog(489679) kelch-like 36 (Drosophila)
cow(768061) kelch-like 36 (Drosophila)
Horse(100056052) kelch-like 36 (Drosophila)
domestic cat(101082614) kelch-like 36 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34616 Anti-C16ORF44 antibody produced in rabbit IgG fraction of antiserum horse, zebrafish, rabbit, mouse, guinea pig, bovine, human, canine, rat
western blot pricing
SAB2100252 Anti-C16ORF44 antibody produced in rabbit affinity isolated antibody bovine, rat, human, guinea pig, rabbit, horse, mouse
western blot pricing
SAB1409820 Anti-KLHL36 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA023423 Anti-KLHL36 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024731 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134081 MISSION® esiRNA esiRNA human C16orf44 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024731 Rosetta Predictions human pricing
NM_001017511 Rosetta Predictions rat pricing
NM_146219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019382 predicted 1225
2 SASI_Hs01_00019383 predicted 398
3 SASI_Hs01_00019384 predicted 1223
4 SASI_Hs01_00019385 predicted 1269
5 SASI_Hs01_00019386 predicted 624
6 SASI_Hs01_00019387 predicted 696
7 SASI_Hs01_00019388 predicted 1788
8 SASI_Hs01_00019390 predicted 1353
9 SASI_Hs01_00019391 predicted 1692
10 SASI_Hs02_00357206 predicted 638
11 SASI_Hs01_00019389 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099059 predicted 1362
2 SASI_Rn01_00099060 predicted 1227
3 SASI_Rn01_00099061 predicted 1192
4 SASI_Rn01_00099062 predicted 641
5 SASI_Rn01_00099063 predicted 581
6 SASI_Rn01_00099064 predicted 1375
7 SASI_Rn01_00099065 predicted 1219
8 SASI_Rn02_00202349 predicted 1771
9 SASI_Rn01_00099067 predicted 607
10 SASI_Rn01_00099068 predicted 655
11 SASI_Rn01_00099066 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106358 predicted 1276
2 SASI_Mm01_00106359 predicted 1224
3 SASI_Mm01_00106360 predicted 1537
4 SASI_Mm01_00106361 predicted 1236
5 SASI_Mm01_00106363 predicted 589
6 SASI_Mm01_00106364 predicted 1081
7 SASI_Mm01_00106365 predicted 1366
8 SASI_Mm01_00106366 predicted 759
9 SASI_Mm01_00106367 predicted 204
10 SASI_Mm02_00341921 predicted 697
11 SASI_Mm01_00106362 predicted 1528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024731
KLHL36 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 36
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-1358s21c1
Sequence:CCGGATGAGAACGGAGCGCTCTCTTCTCGAGAAGAGAGCGCTCCGTTCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-1258s21c1
Sequence:CCGGCGCTGTAAACAGTGGATCAAGCTCGAGCTTGATCCACTGTTTACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-1314s21c1
Sequence:CCGGCCTTGCCTCCATCGAAGACATCTCGAGATGTCTTCGATGGAGGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-613s21c1
Sequence:CCGGTACAGCCTCAAGCGGCTTGATCTCGAGATCAAGCCGCTTGAGGCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024731.2-2049s1c1
Sequence:CCGGCAGCAGCAACTTCTTAGTATTCTCGAGAATACTAAGAAGTTGCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024731.2-2048s1c1
Sequence:CCGGCCAGCAGCAACTTCTTAGTATCTCGAGATACTAAGAAGTTGCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-1226s1c1
Sequence:CCGGCGGCCTCCAATCTTCTTTATACTCGAGTATAAAGAAGATTGGAGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-1644s1c1
Sequence:CCGGCGATGACAACATCGAGTCCATCTCGAGATGGACTCGATGTTGTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-1229s1c1
Sequence:CCGGCCTCCAATCTTCTTTATAGGTCTCGAGACCTATAAAGAAGATTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-189s1c1
Sequence:CCGGCAGCGAATCATCAAAGGTATACTCGAGTATACCTTTGATGATTCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024731
KLHL36 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 36
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-1358s21c1
Sequence:CCGGATGAGAACGGAGCGCTCTCTTCTCGAGAAGAGAGCGCTCCGTTCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-1258s21c1
Sequence:CCGGCGCTGTAAACAGTGGATCAAGCTCGAGCTTGATCCACTGTTTACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-1314s21c1
Sequence:CCGGCCTTGCCTCCATCGAAGACATCTCGAGATGTCTTCGATGGAGGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-613s21c1
Sequence:CCGGTACAGCCTCAAGCGGCTTGATCTCGAGATCAAGCCGCTTGAGGCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024731.2-2049s1c1
Sequence:CCGGCAGCAGCAACTTCTTAGTATTCTCGAGAATACTAAGAAGTTGCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024731.2-2048s1c1
Sequence:CCGGCCAGCAGCAACTTCTTAGTATCTCGAGATACTAAGAAGTTGCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-1226s1c1
Sequence:CCGGCGGCCTCCAATCTTCTTTATACTCGAGTATAAAGAAGATTGGAGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-1644s1c1
Sequence:CCGGCGATGACAACATCGAGTCCATCTCGAGATGGACTCGATGTTGTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-1229s1c1
Sequence:CCGGCCTCCAATCTTCTTTATAGGTCTCGAGACCTATAAAGAAGATTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-189s1c1
Sequence:CCGGCAGCGAATCATCAAAGGTATACTCGAGTATACCTTTGATGATTCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024731
KLHL36 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 36
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-1358s21c1
Sequence:CCGGATGAGAACGGAGCGCTCTCTTCTCGAGAAGAGAGCGCTCCGTTCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-1258s21c1
Sequence:CCGGCGCTGTAAACAGTGGATCAAGCTCGAGCTTGATCCACTGTTTACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-1314s21c1
Sequence:CCGGCCTTGCCTCCATCGAAGACATCTCGAGATGTCTTCGATGGAGGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024731.2-613s21c1
Sequence:CCGGTACAGCCTCAAGCGGCTTGATCTCGAGATCAAGCCGCTTGAGGCTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024731.2-2049s1c1
Sequence:CCGGCAGCAGCAACTTCTTAGTATTCTCGAGAATACTAAGAAGTTGCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024731.2-2048s1c1
Sequence:CCGGCCAGCAGCAACTTCTTAGTATCTCGAGATACTAAGAAGTTGCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-1226s1c1
Sequence:CCGGCGGCCTCCAATCTTCTTTATACTCGAGTATAAAGAAGATTGGAGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-1644s1c1
Sequence:CCGGCGATGACAACATCGAGTCCATCTCGAGATGGACTCGATGTTGTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-1229s1c1
Sequence:CCGGCCTCCAATCTTCTTTATAGGTCTCGAGACCTATAAAGAAGATTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024731.2-189s1c1
Sequence:CCGGCAGCGAATCATCAAAGGTATACTCGAGTATACCTTTGATGATTCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146219
KLHL36 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 36
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-445s21c1
Sequence:CCGGGCTCAAGGCCGTGGTAGATTTCTCGAGAAATCTACCACGGCCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-1271s21c1
Sequence:CCGGCGCCGTAAACAGTGGATCAAGCTCGAGCTTGATCCACTGTTTACGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-538s21c1
Sequence:CCGGGATCTGGACCGTGGTGGATTTCTCGAGAAATCCACCACGGTCCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-1440s21c1
Sequence:CCGGGCTTGCCAAGGTTCACCTATGCTCGAGCATAGGTGAACCTTGGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-1371s21c1
Sequence:CCCGACGAGAATGGAGCGCTGTCTTCTCGAGAAGACAGCGCTCCATTCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-1239s1c1
Sequence:CCGGCCGCCTCCAACCTTCTTTATACTCGAGTATAAAGAAGGTTGGAGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-493s1c1
Sequence:CCGGCGGCAGCAACATTGACTACATCTCGAGATGTAGTCAATGTTGCTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-590s1c1
Sequence:CCGGGAGGACAACTATCTCTACCTACTCGAGTAGGTAGAGATAGTTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-1532s1c1
Sequence:CCGGCGCAAGAACCTGCTGTGTTATCTCGAGATAACACAGCAGGTTCTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146219.1-205s1c1
Sequence:CCGGCAGTGAGTCTTCAAAGGTGTACTCGAGTACACCTTTGAAGACTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146219.1-1319s1c1
Sequence:CCGGGATTTCTACCTAGCTTCCATTCTCGAGAATGGAAGCTAGGTAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-758s1c1
Sequence:CCGGCAGGTACAGCACAAATGGGAACTCGAGTTCCCATTTGTGCTGTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146219
KLHL36 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 36
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-445s21c1
Sequence:CCGGGCTCAAGGCCGTGGTAGATTTCTCGAGAAATCTACCACGGCCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-1271s21c1
Sequence:CCGGCGCCGTAAACAGTGGATCAAGCTCGAGCTTGATCCACTGTTTACGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-538s21c1
Sequence:CCGGGATCTGGACCGTGGTGGATTTCTCGAGAAATCCACCACGGTCCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-1440s21c1
Sequence:CCGGGCTTGCCAAGGTTCACCTATGCTCGAGCATAGGTGAACCTTGGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-1371s21c1
Sequence:CCCGACGAGAATGGAGCGCTGTCTTCTCGAGAAGACAGCGCTCCATTCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-1239s1c1
Sequence:CCGGCCGCCTCCAACCTTCTTTATACTCGAGTATAAAGAAGGTTGGAGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-493s1c1
Sequence:CCGGCGGCAGCAACATTGACTACATCTCGAGATGTAGTCAATGTTGCTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-590s1c1
Sequence:CCGGGAGGACAACTATCTCTACCTACTCGAGTAGGTAGAGATAGTTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-1532s1c1
Sequence:CCGGCGCAAGAACCTGCTGTGTTATCTCGAGATAACACAGCAGGTTCTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146219.1-205s1c1
Sequence:CCGGCAGTGAGTCTTCAAAGGTGTACTCGAGTACACCTTTGAAGACTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146219.1-1319s1c1
Sequence:CCGGGATTTCTACCTAGCTTCCATTCTCGAGAATGGAAGCTAGGTAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-758s1c1
Sequence:CCGGCAGGTACAGCACAAATGGGAACTCGAGTTCCCATTTGTGCTGTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146219
KLHL36 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 36
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-445s21c1
Sequence:CCGGGCTCAAGGCCGTGGTAGATTTCTCGAGAAATCTACCACGGCCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-1271s21c1
Sequence:CCGGCGCCGTAAACAGTGGATCAAGCTCGAGCTTGATCCACTGTTTACGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-538s21c1
Sequence:CCGGGATCTGGACCGTGGTGGATTTCTCGAGAAATCCACCACGGTCCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-1440s21c1
Sequence:CCGGGCTTGCCAAGGTTCACCTATGCTCGAGCATAGGTGAACCTTGGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146219.1-1371s21c1
Sequence:CCCGACGAGAATGGAGCGCTGTCTTCTCGAGAAGACAGCGCTCCATTCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-1239s1c1
Sequence:CCGGCCGCCTCCAACCTTCTTTATACTCGAGTATAAAGAAGGTTGGAGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-493s1c1
Sequence:CCGGCGGCAGCAACATTGACTACATCTCGAGATGTAGTCAATGTTGCTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-590s1c1
Sequence:CCGGGAGGACAACTATCTCTACCTACTCGAGTAGGTAGAGATAGTTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-1532s1c1
Sequence:CCGGCGCAAGAACCTGCTGTGTTATCTCGAGATAACACAGCAGGTTCTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146219.1-205s1c1
Sequence:CCGGCAGTGAGTCTTCAAAGGTGTACTCGAGTACACCTTTGAAGACTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146219.1-1319s1c1
Sequence:CCGGGATTTCTACCTAGCTTCCATTCTCGAGAATGGAAGCTAGGTAGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146219.1-758s1c1
Sequence:CCGGCAGGTACAGCACAAATGGGAACTCGAGTTCCCATTTGTGCTGTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)