EMAIL THIS PAGE TO A FRIEND

KLHL38

kelch-like family member 38

48 Gene Product Result for
Synonyms: C8ORFK36
UniProtKB ID: Q2WGJ6, A0PK12
Gene ID:
Mouse(268807) kelch-like 38
Rat(314996) kelch-like family member 38
Zebrafish(559083) kelch-like 38 (Drosophila)
chicken(428388) kelch-like 38 (Drosophila)
dog(609348) kelch-like 38 (Drosophila)
cow(516476) kelch-like family member 38
domestic cat(101080685) kelch-like 38 (Drosophila)
sheep(101107608) kelch-like 38 (Drosophila)
Domestic Rabbit(100351650) kelch-like 38 (Drosophila)
domestic guinea pig(100735450) kelch-like family member 38
naked mole-rat(101717924) kelch-like family member 38
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001081675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001081675 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066471 MISSION® esiRNA esiRNA human KLHL38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081675 Rosetta Predictions human pricing
NM_001025008 Rosetta Predictions rat pricing
NM_177755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316513 predicted 1358
2 SASI_Hs02_00316514 predicted 1075
3 SASI_Hs02_00316515 predicted 1226
4 SASI_Hs02_00316516 predicted 1386
5 SASI_Hs02_00316517 predicted 434
6 SASI_Hs02_00316518 predicted 1507
7 SASI_Hs02_00316519 predicted 1377
8 SASI_Hs02_00316520 predicted 376
9 SASI_Hs02_00316521 predicted 203
10 SASI_Hs02_00316522 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094119 predicted 1993
2 SASI_Rn01_00094120 predicted 335
3 SASI_Rn01_00094121 predicted 1015
4 SASI_Rn01_00094123 predicted 683
5 SASI_Rn01_00094124 predicted 669
6 SASI_Rn01_00094125 predicted 1579
7 SASI_Rn01_00094126 predicted 1594
8 SASI_Rn01_00094127 predicted 1529
9 SASI_Rn01_00094128 predicted 1192
10 SASI_Rn02_00202915 predicted 1447
11 SASI_Rn01_00094122 predicted 1688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099858 predicted 651
2 SASI_Mm01_00099859 predicted 1965
3 SASI_Mm01_00099860 predicted 1354
4 SASI_Mm01_00099861 predicted 1708
5 SASI_Mm01_00099862 predicted 566
6 SASI_Mm01_00099863 predicted 640
7 SASI_Mm01_00099864 predicted 1488
8 SASI_Mm01_00099865 predicted 1494
9 SASI_Mm01_00099866 predicted 1560
10 SASI_Mm01_00099867 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177755
KLHL38 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 38
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177755.2-1966s1c1
Sequence:CCGGCAGGAACTTATCTCTGTCCAACTCGAGTTGGACAGAGATAAGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177755.2-1013s1c1
Sequence:CCGGCCCAGGATTGTAAACTCCTATCTCGAGATAGGAGTTTACAATCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177755.2-471s1c1
Sequence:CCGGGCAGGTCATTACGTATGTGTACTCGAGTACACATACGTAATGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177755.2-626s1c1
Sequence:CCGGGCCTAGTCAGACTCGCAGAAACTCGAGTTTCTGCGAGTCTGACTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177755
KLHL38 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 38
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177755.2-1966s1c1
Sequence:CCGGCAGGAACTTATCTCTGTCCAACTCGAGTTGGACAGAGATAAGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177755.2-1013s1c1
Sequence:CCGGCCCAGGATTGTAAACTCCTATCTCGAGATAGGAGTTTACAATCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177755.2-471s1c1
Sequence:CCGGGCAGGTCATTACGTATGTGTACTCGAGTACACATACGTAATGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177755.2-626s1c1
Sequence:CCGGGCCTAGTCAGACTCGCAGAAACTCGAGTTTCTGCGAGTCTGACTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177755
KLHL38 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 38
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177755.2-1966s1c1
Sequence:CCGGCAGGAACTTATCTCTGTCCAACTCGAGTTGGACAGAGATAAGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177755.2-1013s1c1
Sequence:CCGGCCCAGGATTGTAAACTCCTATCTCGAGATAGGAGTTTACAATCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177755.2-471s1c1
Sequence:CCGGGCAGGTCATTACGTATGTGTACTCGAGTACACATACGTAATGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177755.2-626s1c1
Sequence:CCGGGCCTAGTCAGACTCGCAGAAACTCGAGTTTCTGCGAGTCTGACTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081675
KLHL38 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 38
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-1616s21c1
Sequence:CCGGTGACCACGGACTGCAACATTGCTCGAGCAATGTTGCAGTCCGTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-1367s21c1
Sequence:CCGGTTATCCAGGTTTATCACATTTCTCGAGAAATGTGATAAACCTGGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-1505s21c1
Sequence:CCGGATGACCCTCAATCCAACAAATCTCGAGATTTGTTGGATTGAGGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-443s21c1
Sequence:CCGGTCAGACTCTCAGAAATCTTAACTCGAGTTAAGATTTCTGAGAGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-284s21c1
Sequence:CCGGAGATCGTCTCCTACGTGTATACTCGAGTATACACGTAGGAGACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081675
KLHL38 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 38
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-1616s21c1
Sequence:CCGGTGACCACGGACTGCAACATTGCTCGAGCAATGTTGCAGTCCGTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-1367s21c1
Sequence:CCGGTTATCCAGGTTTATCACATTTCTCGAGAAATGTGATAAACCTGGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-1505s21c1
Sequence:CCGGATGACCCTCAATCCAACAAATCTCGAGATTTGTTGGATTGAGGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-443s21c1
Sequence:CCGGTCAGACTCTCAGAAATCTTAACTCGAGTTAAGATTTCTGAGAGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-284s21c1
Sequence:CCGGAGATCGTCTCCTACGTGTATACTCGAGTATACACGTAGGAGACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081675
KLHL38 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 38
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-1616s21c1
Sequence:CCGGTGACCACGGACTGCAACATTGCTCGAGCAATGTTGCAGTCCGTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-1367s21c1
Sequence:CCGGTTATCCAGGTTTATCACATTTCTCGAGAAATGTGATAAACCTGGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-1505s21c1
Sequence:CCGGATGACCCTCAATCCAACAAATCTCGAGATTTGTTGGATTGAGGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-443s21c1
Sequence:CCGGTCAGACTCTCAGAAATCTTAACTCGAGTTAAGATTTCTGAGAGTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081675.2-284s21c1
Sequence:CCGGAGATCGTCTCCTACGTGTATACTCGAGTATACACGTAGGAGACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)