EMAIL THIS PAGE TO A FRIEND

KLHL3

kelch-like family member 3

287 Gene Product Result for
Synonyms: PHA2D
UniProtKB ID: Q9UH77, B2RBK7, Q9UH75, Q9UH76, Q9ULU0, Q9Y6V6
Gene ID:
Human(26249) Summary: This gene is ubiquitously expressed and encodes a full-length protein which has an N-terminal BTB domain followed by a BACK domain and six kelch-like repeats in the C-terminus. These kelch-like repeats promote substrate ubiquitination of bound proteins via interaction of the BTB domain with the CUL3 (cullin 3) component of a cullin-RING E3 ubiquitin ligase (CRL) complex. Muatations in this gene cause pseudohypoaldosteronism type IID (PHA2D); a rare Mendelian syndrome featuring hypertension, hyperkalaemia and metabolic acidosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
Mouse(100503085) kelch-like 3
Rat(498697) kelch-like family member 3
Zebrafish(568556) kelch-like 3 (Drosophila)
chicken(416303) kelch-like 3 (Drosophila)
domestic cat(101083647) kelch-like 3 (Drosophila)
cow(533364) kelch-like family member 3
Horse(100062564) kelch-like 3 (Drosophila)
dog(481523) kelch-like 3 (Drosophila)
sheep(101107091) kelch-like 3 (Drosophila)
Domestic Rabbit(100343290) kelch-like 3 (Drosophila)
domestic guinea pig(100732587) kelch-like family member 3
naked mole-rat(101699865) kelch-like family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017415 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075021 MISSION® esiRNA esiRNA human KLHL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017415 Rosetta Predictions human pricing
XM_573982 Rosetta Predictions rat pricing
XR_008432 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349978 predicted 1197
2 SASI_Hs01_00168491 predicted 1176
3 SASI_Hs01_00168492 predicted 2043
4 SASI_Hs01_00168494 predicted 1078
5 SASI_Hs01_00168496 predicted 1287
6 SASI_Hs01_00168497 predicted 1864
7 SASI_Hs01_00168498 predicted 681
8 SASI_Hs01_00168499 predicted 2178
9 SASI_Hs02_00349979 predicted 449
10 SASI_Hs02_00349980 predicted 2190
11 SASI_Hs01_00168490 predicted 428
12 SASI_Hs01_00168493 predicted 265
13 SASI_Hs01_00168495 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401130 predicted 312
2 SASI_Rn02_00401131 predicted 834
3 SASI_Rn02_00401132 predicted 733
4 SASI_Rn02_00401133 predicted 1736
5 SASI_Rn02_00401134 predicted 1596
6 SASI_Rn02_00401135 predicted 114
7 SASI_Rn02_00401136 predicted 399
8 SASI_Rn02_00401137 predicted 1324
9 SASI_Rn02_00401138 predicted 790
10 SASI_Rn02_00401139 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008432 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00417025 predicted 361
2 SASI_Rn02_00417026 predicted 428
3 SASI_Rn02_00417027 predicted 493
4 SASI_Rn02_00417028 predicted 415
5 SASI_Rn02_00417029 predicted 541
6 SASI_Rn02_00417030 predicted 342
7 SASI_Rn02_00417031 predicted 413
8 SASI_Rn02_00417032 predicted 221
9 SASI_Rn02_00417033 predicted 516
10 SASI_Rn02_00417034 predicted 530
11 SASI_Rn01_00154553 predicted 1805
12 SASI_Rn01_00154554 predicted 1775
13 SASI_Rn01_00154555 predicted 1842
14 SASI_Rn01_00154556 predicted 1848
15 SASI_Rn01_00154557 predicted 1863
16 SASI_Rn01_00154558 predicted 2526
17 SASI_Rn01_00154559 predicted 2449
18 SASI_Rn01_00154560 predicted 1843
19 SASI_Rn01_00154561 predicted 1762
20 SASI_Rn01_00154562 predicted 2534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017415
VALIDATED
KLHL3 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-2174s21c1
Sequence:CCGGATGCAGGTGTTGCCGTGATTCCTCGAGGAATCACGGCAACACCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-562s21c1
Sequence:CCGGATGAATGAACTGCGGAGTAAACTCGAGTTTACTCCGCAGTTCATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-1492s21c1
Sequence:CCGGTATGCCGTGGGAGGGTTTAATCTCGAGATTAAACCCTCCCACGGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017415.2-2666s21c1
Sequence:CCGGGGGACCCTGAGACTACTAAAGCTCGAGCTTTAGTAGTCTCAGGGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-607s21c1
Sequence:CCGGGTGGCAGAAGATGTCGAGATACTCGAGTATCTCGACATCTTCTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-1521s1c1
Sequence:CCGGCCAGCGACCAATGAATGGATACTCGAGTATCCATTCATTGGTCGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017415.1-1782s1c1
Sequence:CCGGGCTTCGGTGGAGTACTACAATCTCGAGATTGTAGTACTCCACCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-1728s1c1
Sequence:CCGGGCAGTAAATGGGCTCCTGTATCTCGAGATACAGGAGCCCATTTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017415.1-291s1c1
Sequence:CCGGGTGGCAGAAGATGTCGAGATACTCGAGTATCTCGACATCTTCTGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-562s1c1
Sequence:CCGGCTCAGTTGCATCCCACCAATTCTCGAGAATTGGTGGGATGCAACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017415.1-294s1c1
Sequence:CCGGGCAGAAGATGTCGAGATAGAACTCGAGTTCTATCTCGACATCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-1522s1c1
Sequence:CCGGCAGCGACCAATGAATGGATATCTCGAGATATCCATTCATTGGTCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-774s1c1
Sequence:CCGGGCTGTGATCTCATGGATCAATCTCGAGATTGATCCATGAGATCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017415.1-3254s1c1
Sequence:CCGGGCTTTGCTAATTCACAGGTAACTCGAGTTACCTGTGAATTAGCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017415.1-3804s1c1
Sequence:CCGGCCTGGAAGAAATGTCTCCAAACTCGAGTTTGGAGACATTTCTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017415
VALIDATED
KLHL3 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-2174s21c1
Sequence:CCGGATGCAGGTGTTGCCGTGATTCCTCGAGGAATCACGGCAACACCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-562s21c1
Sequence:CCGGATGAATGAACTGCGGAGTAAACTCGAGTTTACTCCGCAGTTCATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-1492s21c1
Sequence:CCGGTATGCCGTGGGAGGGTTTAATCTCGAGATTAAACCCTCCCACGGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017415.2-2666s21c1
Sequence:CCGGGGGACCCTGAGACTACTAAAGCTCGAGCTTTAGTAGTCTCAGGGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-607s21c1
Sequence:CCGGGTGGCAGAAGATGTCGAGATACTCGAGTATCTCGACATCTTCTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-1521s1c1
Sequence:CCGGCCAGCGACCAATGAATGGATACTCGAGTATCCATTCATTGGTCGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017415.1-1782s1c1
Sequence:CCGGGCTTCGGTGGAGTACTACAATCTCGAGATTGTAGTACTCCACCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-1728s1c1
Sequence:CCGGGCAGTAAATGGGCTCCTGTATCTCGAGATACAGGAGCCCATTTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017415.1-291s1c1
Sequence:CCGGGTGGCAGAAGATGTCGAGATACTCGAGTATCTCGACATCTTCTGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-562s1c1
Sequence:CCGGCTCAGTTGCATCCCACCAATTCTCGAGAATTGGTGGGATGCAACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017415.1-294s1c1
Sequence:CCGGGCAGAAGATGTCGAGATAGAACTCGAGTTCTATCTCGACATCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-1522s1c1
Sequence:CCGGCAGCGACCAATGAATGGATATCTCGAGATATCCATTCATTGGTCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-774s1c1
Sequence:CCGGGCTGTGATCTCATGGATCAATCTCGAGATTGATCCATGAGATCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017415.1-3254s1c1
Sequence:CCGGGCTTTGCTAATTCACAGGTAACTCGAGTTACCTGTGAATTAGCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017415.1-3804s1c1
Sequence:CCGGCCTGGAAGAAATGTCTCCAAACTCGAGTTTGGAGACATTTCTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017415
VALIDATED
KLHL3 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-2174s21c1
Sequence:CCGGATGCAGGTGTTGCCGTGATTCCTCGAGGAATCACGGCAACACCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-562s21c1
Sequence:CCGGATGAATGAACTGCGGAGTAAACTCGAGTTTACTCCGCAGTTCATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-1492s21c1
Sequence:CCGGTATGCCGTGGGAGGGTTTAATCTCGAGATTAAACCCTCCCACGGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017415.2-2666s21c1
Sequence:CCGGGGGACCCTGAGACTACTAAAGCTCGAGCTTTAGTAGTCTCAGGGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017415.2-607s21c1
Sequence:CCGGGTGGCAGAAGATGTCGAGATACTCGAGTATCTCGACATCTTCTGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-1521s1c1
Sequence:CCGGCCAGCGACCAATGAATGGATACTCGAGTATCCATTCATTGGTCGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017415.1-1782s1c1
Sequence:CCGGGCTTCGGTGGAGTACTACAATCTCGAGATTGTAGTACTCCACCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-1728s1c1
Sequence:CCGGGCAGTAAATGGGCTCCTGTATCTCGAGATACAGGAGCCCATTTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017415.1-291s1c1
Sequence:CCGGGTGGCAGAAGATGTCGAGATACTCGAGTATCTCGACATCTTCTGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-562s1c1
Sequence:CCGGCTCAGTTGCATCCCACCAATTCTCGAGAATTGGTGGGATGCAACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017415.1-294s1c1
Sequence:CCGGGCAGAAGATGTCGAGATAGAACTCGAGTTCTATCTCGACATCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-1522s1c1
Sequence:CCGGCAGCGACCAATGAATGGATATCTCGAGATATCCATTCATTGGTCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017415.1-774s1c1
Sequence:CCGGGCTGTGATCTCATGGATCAATCTCGAGATTGATCCATGAGATCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017415.1-3254s1c1
Sequence:CCGGGCTTTGCTAATTCACAGGTAACTCGAGTTACCTGTGAATTAGCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017415.1-3804s1c1
Sequence:CCGGCCTGGAAGAAATGTCTCCAAACTCGAGTTTGGAGACATTTCTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)