EMAIL THIS PAGE TO A FRIEND

KLHL40

kelch-like family member 40

61 Gene Product Result for
Synonyms: KBTBD5 NEM8 SRYP SYRP
UniProtKB ID: Q2TBA0, Q86SI1, Q96MR2
Gene ID:
Human(131377) Summary: This gene encodes a protein containing a BACK domain, a BTB/POZ domain, and 5 Kelch repeats, however, its exact function is not known. The gene and the multi-domain protein structure are conserved across different taxa, including primates, rodents, chicken and zebrafish. [provided by RefSeq, Dec 2012]
Mouse(72330) kelch-like 40
Rat(316088) kelch-like family member 40
domestic guinea pig(100733725) kelch-like family member 40
naked mole-rat(101714895) kelch-like family member 40
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152393 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152393 Rosetta Predictions human pricing
NM_001108195 Rosetta Predictions rat pricing
NM_028202 Rosetta Predictions mouse pricing
XM_914285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141638 predicted 940
2 SASI_Hs01_00141639 predicted 1046
3 SASI_Hs01_00141640 predicted 260
4 SASI_Hs01_00141641 predicted 946
5 SASI_Hs02_00366066 predicted 400
6 SASI_Hs01_00141642 predicted 1323
7 SASI_Hs01_00141643 predicted 2116
8 SASI_Hs01_00141644 predicted 1229
9 SASI_Hs01_00141645 predicted 954
10 SASI_Hs01_00141646 predicted 1248
11 SASI_Hs01_00141647 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236264 predicted 1314
2 SASI_Rn02_00236265 predicted 937
3 SASI_Rn02_00236266 predicted 411
4 SASI_Rn02_00236267 predicted 261
5 SASI_Rn02_00236268 predicted 1226
6 SASI_Rn02_00236269 predicted 1207
7 SASI_Rn02_00236270 predicted 1036
8 SASI_Rn02_00236271 predicted 977
9 SASI_Rn02_00236272 predicted 1504
10 SASI_Rn02_00236273 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333520 predicted 1589
2 SASI_Mm02_00333521 predicted 417
3 SASI_Mm02_00333522 predicted 817
4 SASI_Mm02_00333523 predicted 958
5 SASI_Mm02_00333524 predicted 1250
6 SASI_Mm02_00333525 predicted 1452
7 SASI_Mm02_00333526 predicted 485
8 SASI_Mm02_00333527 predicted 1418
9 SASI_Mm02_00333528 predicted 1620
10 SASI_Mm02_00333529 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203497 predicted 3082
2 SASI_Mm01_00203498 predicted 3652
3 SASI_Mm01_00203499 predicted 3514
4 SASI_Mm01_00203500 predicted 3880
5 SASI_Mm01_00203501 predicted 4101
6 SASI_Mm01_00203502 predicted 3142
7 SASI_Mm01_00203503 predicted 3626
8 SASI_Mm01_00203504 predicted 3640
9 SASI_Mm01_00203505 predicted 3541
10 SASI_Mm01_00203506 predicted 3687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152393
KLHL40 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 40
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152393.2-1528s1c1
Sequence:CCGGCCTGAACAAGATGTGCGTCTACTCGAGTAGACGCACATCTTGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152393.2-947s1c1
Sequence:CCGGGCTGATAAGGGCACAAGCAAACTCGAGTTTGCTTGTGCCCTTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152393.2-2189s1c1
Sequence:CCGGCCCTAGGTTGTCTTGATCCATCTCGAGATGGATCAAGACAACCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-361s1c1
Sequence:CCGGCTACCTGTACACATCAGAGATCTCGAGATCTCTGATGTGTACAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1048s1c1
Sequence:CCGGGCAGGATCTCATCTTCATGATCTCGAGATCATGAAGATGAGATCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152393.2-2198s1c1
Sequence:CCGGGTCTTGATCCATGAACCAGAACTCGAGTTCTGGTTCATGGATCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1687s1c1
Sequence:CCGGGTACAGCATCACAGACAACAACTCGAGTTGTTGTCTGTGATGCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1838s1c1
Sequence:CCGGCTCAATGACATCTGGAGGTATCTCGAGATACCTCCAGATGTCATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1198s1c1
Sequence:CCGGCCTCTTCTACAACGAAGACAACTCGAGTTGTCTTCGTTGTAGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152393.2-1529s1c1
Sequence:CCGGCTGAACAAGATGTGCGTCTATCTCGAGATAGACGCACATCTTGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152393
KLHL40 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 40
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152393.2-1528s1c1
Sequence:CCGGCCTGAACAAGATGTGCGTCTACTCGAGTAGACGCACATCTTGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152393.2-947s1c1
Sequence:CCGGGCTGATAAGGGCACAAGCAAACTCGAGTTTGCTTGTGCCCTTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152393.2-2189s1c1
Sequence:CCGGCCCTAGGTTGTCTTGATCCATCTCGAGATGGATCAAGACAACCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-361s1c1
Sequence:CCGGCTACCTGTACACATCAGAGATCTCGAGATCTCTGATGTGTACAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1048s1c1
Sequence:CCGGGCAGGATCTCATCTTCATGATCTCGAGATCATGAAGATGAGATCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152393.2-2198s1c1
Sequence:CCGGGTCTTGATCCATGAACCAGAACTCGAGTTCTGGTTCATGGATCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1687s1c1
Sequence:CCGGGTACAGCATCACAGACAACAACTCGAGTTGTTGTCTGTGATGCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1838s1c1
Sequence:CCGGCTCAATGACATCTGGAGGTATCTCGAGATACCTCCAGATGTCATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1198s1c1
Sequence:CCGGCCTCTTCTACAACGAAGACAACTCGAGTTGTCTTCGTTGTAGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152393.2-1529s1c1
Sequence:CCGGCTGAACAAGATGTGCGTCTATCTCGAGATAGACGCACATCTTGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152393
KLHL40 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 40
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152393.2-1528s1c1
Sequence:CCGGCCTGAACAAGATGTGCGTCTACTCGAGTAGACGCACATCTTGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152393.2-947s1c1
Sequence:CCGGGCTGATAAGGGCACAAGCAAACTCGAGTTTGCTTGTGCCCTTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152393.2-2189s1c1
Sequence:CCGGCCCTAGGTTGTCTTGATCCATCTCGAGATGGATCAAGACAACCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-361s1c1
Sequence:CCGGCTACCTGTACACATCAGAGATCTCGAGATCTCTGATGTGTACAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1048s1c1
Sequence:CCGGGCAGGATCTCATCTTCATGATCTCGAGATCATGAAGATGAGATCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152393.2-2198s1c1
Sequence:CCGGGTCTTGATCCATGAACCAGAACTCGAGTTCTGGTTCATGGATCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1687s1c1
Sequence:CCGGGTACAGCATCACAGACAACAACTCGAGTTGTTGTCTGTGATGCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1838s1c1
Sequence:CCGGCTCAATGACATCTGGAGGTATCTCGAGATACCTCCAGATGTCATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152393.2-1198s1c1
Sequence:CCGGCCTCTTCTACAACGAAGACAACTCGAGTTGTCTTCGTTGTAGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152393.2-1529s1c1
Sequence:CCGGCTGAACAAGATGTGCGTCTATCTCGAGATAGACGCACATCTTGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028202
KLHL40 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 40
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-1688s21c1
Sequence:CCGGAGCCTAGCTGGCACTCTTTATCTCGAGATAAAGAGTGCCAGCTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-1332s21c1
Sequence:CCGGACGACAGGCTGTCATTCAAATCTCGAGATTTGAATGACAGCCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028202.2-2054s21c1
Sequence:CCGGTCAGTCAGGGAAGGGACATTGCTCGAGCAATGTCCCTTCCCTGACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-378s21c1
Sequence:CCGGTCACCATCTGCGTGTCGTTTCCTCGAGGAAACGACACGCAGATGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-324s21c1
Sequence:CCGGCAAGCGTGCAAGACCTGTTTGCTCGAGCAAACAGGTCTTGCACGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028202
KLHL40 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 40
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-1688s21c1
Sequence:CCGGAGCCTAGCTGGCACTCTTTATCTCGAGATAAAGAGTGCCAGCTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-1332s21c1
Sequence:CCGGACGACAGGCTGTCATTCAAATCTCGAGATTTGAATGACAGCCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028202.2-2054s21c1
Sequence:CCGGTCAGTCAGGGAAGGGACATTGCTCGAGCAATGTCCCTTCCCTGACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-378s21c1
Sequence:CCGGTCACCATCTGCGTGTCGTTTCCTCGAGGAAACGACACGCAGATGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-324s21c1
Sequence:CCGGCAAGCGTGCAAGACCTGTTTGCTCGAGCAAACAGGTCTTGCACGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028202
KLHL40 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 40
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-1688s21c1
Sequence:CCGGAGCCTAGCTGGCACTCTTTATCTCGAGATAAAGAGTGCCAGCTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-1332s21c1
Sequence:CCGGACGACAGGCTGTCATTCAAATCTCGAGATTTGAATGACAGCCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028202.2-2054s21c1
Sequence:CCGGTCAGTCAGGGAAGGGACATTGCTCGAGCAATGTCCCTTCCCTGACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-378s21c1
Sequence:CCGGTCACCATCTGCGTGTCGTTTCCTCGAGGAAACGACACGCAGATGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028202.2-324s21c1
Sequence:CCGGCAAGCGTGCAAGACCTGTTTGCTCGAGCAAACAGGTCTTGCACGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)