EMAIL THIS PAGE TO A FRIEND

KLHL41

kelch-like family member 41

65 Gene Product Result for
Synonyms: KBTBD10 Krp1 SARCOSIN
UniProtKB ID: O60662, Q53R42
Gene ID:
Mouse(228003) kelch-like 41
Rat(117537) kelch-like family member 41
domestic guinea pig(100735323) kelch-like family member 41
naked mole-rat(101718951) kelch-like family member 41
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006063 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006063 Rosetta Predictions human pricing
NM_057191 Rosetta Predictions rat pricing
NM_001081087 Rosetta Predictions mouse pricing
XM_130293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096214 predicted 651
2 SASI_Hs01_00096215 predicted 536
3 SASI_Hs01_00096216 predicted 671
4 SASI_Hs01_00096217 predicted 1307
5 SASI_Hs01_00096218 predicted 715
6 SASI_Hs01_00096219 predicted 941
7 SASI_Hs01_00096220 predicted 1190
8 SASI_Hs02_00340823 predicted 1272
9 SASI_Hs01_00096221 predicted 1727
10 SASI_Hs01_00096223 predicted 1450
11 SASI_Hs01_00096222 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049034 predicted 1799
2 SASI_Rn01_00049036 predicted 862
3 SASI_Rn01_00049037 predicted 239
4 SASI_Rn01_00049038 predicted 1341
5 SASI_Rn02_00267142 predicted 472
6 SASI_Rn01_00049040 predicted 1110
7 SASI_Rn01_00049041 predicted 1546
8 SASI_Rn01_00049042 predicted 1804
9 SASI_Rn01_00049043 predicted 1857
10 SASI_Rn02_00267143 predicted 999
11 SASI_Rn01_00049035 predicted 1751
12 SASI_Rn01_00049039 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295051 predicted 576
2 SASI_Mm02_00295052 predicted 1871
3 SASI_Mm02_00295053 predicted 1453
4 SASI_Mm02_00295054 predicted 1776
5 SASI_Mm02_00295055 predicted 554
6 SASI_Mm02_00295056 predicted 1071
7 SASI_Mm02_00295057 predicted 745
8 SASI_Mm02_00295058 predicted 1390
9 SASI_Mm02_00295059 predicted 1289
10 SASI_Mm02_00295060 predicted 1525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205390 predicted 583
2 SASI_Mm01_00205391 predicted 1873
3 SASI_Mm01_00205392 predicted 1459
4 SASI_Mm01_00205393 predicted 562
5 SASI_Mm01_00205394 predicted 1635
6 SASI_Mm01_00205395 predicted 1888
7 SASI_Mm01_00205396 predicted 1077
8 SASI_Mm01_00205397 predicted 748
9 SASI_Mm01_00205398 predicted 1393
10 SASI_Mm01_00205399 predicted 1530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006063
KLHL41 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 41
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006063.2-363s21c1
Sequence:CCGGATTGATCTCAATGACGGAAATCTCGAGATTTCCGTCATTGAGATCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006063.2-208s21c1
Sequence:CCGGTTCCTTGCCACAGATTGATTTCTCGAGAAATCAATCTGTGGCAAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006063.2-2206s1c1
Sequence:CCGGGCATCATTAGGGTATCCTTAACTCGAGTTAAGGATACCCTAATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006063.2-1316s1c1
Sequence:CCGGGCTGGATTCAGTATTATGCTACTCGAGTAGCATAATACTGAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006063.2-2156s1c1
Sequence:CCGGGATTGTAAAGAAGGCTCCTAACTCGAGTTAGGAGCCTTCTTTACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006063.2-965s1c1
Sequence:CCGGCAGGCATGGAATGTTTGTAAACTCGAGTTTACAAACATTCCATGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183551    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006063.2-2169s1c1
Sequence:CCGGGCTCCTAAATTTGAGTTGTTTCTCGAGAAACAACTCAAATTTAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006063.2-2047s1c1
Sequence:CCGGCCTCAGTCATTGACTCTTCAACTCGAGTTGAAGAGTCAATGACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006063.2-1698s1c1
Sequence:CCGGGCTGGATCTCTGTATGCAATTCTCGAGAATTGCATACAGAGATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006063
KLHL41 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 41
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006063.2-363s21c1
Sequence:CCGGATTGATCTCAATGACGGAAATCTCGAGATTTCCGTCATTGAGATCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006063.2-208s21c1
Sequence:CCGGTTCCTTGCCACAGATTGATTTCTCGAGAAATCAATCTGTGGCAAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006063.2-2206s1c1
Sequence:CCGGGCATCATTAGGGTATCCTTAACTCGAGTTAAGGATACCCTAATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006063.2-1316s1c1
Sequence:CCGGGCTGGATTCAGTATTATGCTACTCGAGTAGCATAATACTGAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006063.2-2156s1c1
Sequence:CCGGGATTGTAAAGAAGGCTCCTAACTCGAGTTAGGAGCCTTCTTTACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006063.2-965s1c1
Sequence:CCGGCAGGCATGGAATGTTTGTAAACTCGAGTTTACAAACATTCCATGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183551    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006063.2-2169s1c1
Sequence:CCGGGCTCCTAAATTTGAGTTGTTTCTCGAGAAACAACTCAAATTTAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006063.2-2047s1c1
Sequence:CCGGCCTCAGTCATTGACTCTTCAACTCGAGTTGAAGAGTCAATGACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006063.2-1698s1c1
Sequence:CCGGGCTGGATCTCTGTATGCAATTCTCGAGAATTGCATACAGAGATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006063
KLHL41 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 41
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006063.2-363s21c1
Sequence:CCGGATTGATCTCAATGACGGAAATCTCGAGATTTCCGTCATTGAGATCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006063.2-208s21c1
Sequence:CCGGTTCCTTGCCACAGATTGATTTCTCGAGAAATCAATCTGTGGCAAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006063.2-2206s1c1
Sequence:CCGGGCATCATTAGGGTATCCTTAACTCGAGTTAAGGATACCCTAATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006063.2-1316s1c1
Sequence:CCGGGCTGGATTCAGTATTATGCTACTCGAGTAGCATAATACTGAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006063.2-2156s1c1
Sequence:CCGGGATTGTAAAGAAGGCTCCTAACTCGAGTTAGGAGCCTTCTTTACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006063.2-965s1c1
Sequence:CCGGCAGGCATGGAATGTTTGTAAACTCGAGTTTACAAACATTCCATGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183551    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006063.2-2169s1c1
Sequence:CCGGGCTCCTAAATTTGAGTTGTTTCTCGAGAAACAACTCAAATTTAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006063.2-2047s1c1
Sequence:CCGGCCTCAGTCATTGACTCTTCAACTCGAGTTGAAGAGTCAATGACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006063.2-1698s1c1
Sequence:CCGGGCTGGATCTCTGTATGCAATTCTCGAGAATTGCATACAGAGATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081087
KLHL41 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 41
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-242s21c1
Sequence:CCGGCCCTTACTTCCGTGAGTATTTCTCGAGAAATACTCACGGAAGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-1854s21c1
Sequence:CCGGTGCCTAGCAACGCGCTTAAATCTCGAGATTTAAGCGCGTTGCTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081087.1-2363s21c1
Sequence:CCGGCATCTACTTGTTGTCTATTATCTCGAGATAATAGACAACAAGTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-1456s21c1
Sequence:CCGGAGTGTACAAATAGGGTATTTACTCGAGTAAATACCCTATTTGTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-782s21c1
Sequence:CCGGTGTCGAGAAAGATGACATAATCTCGAGATTATGTCATCTTTCTCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081087
KLHL41 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 41
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-242s21c1
Sequence:CCGGCCCTTACTTCCGTGAGTATTTCTCGAGAAATACTCACGGAAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-1854s21c1
Sequence:CCGGTGCCTAGCAACGCGCTTAAATCTCGAGATTTAAGCGCGTTGCTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081087.1-2363s21c1
Sequence:CCGGCATCTACTTGTTGTCTATTATCTCGAGATAATAGACAACAAGTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-1456s21c1
Sequence:CCGGAGTGTACAAATAGGGTATTTACTCGAGTAAATACCCTATTTGTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-782s21c1
Sequence:CCGGTGTCGAGAAAGATGACATAATCTCGAGATTATGTCATCTTTCTCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081087
KLHL41 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 41
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-242s21c1
Sequence:CCGGCCCTTACTTCCGTGAGTATTTCTCGAGAAATACTCACGGAAGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-1854s21c1
Sequence:CCGGTGCCTAGCAACGCGCTTAAATCTCGAGATTTAAGCGCGTTGCTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081087.1-2363s21c1
Sequence:CCGGCATCTACTTGTTGTCTATTATCTCGAGATAATAGACAACAAGTAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-1456s21c1
Sequence:CCGGAGTGTACAAATAGGGTATTTACTCGAGTAAATACCCTATTTGTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081087.1-782s21c1
Sequence:CCGGTGTCGAGAAAGATGACATAATCTCGAGATTATGTCATCTTTCTCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)