EMAIL THIS PAGE TO A FRIEND

KLHL42

kelch-like family member 42

139 Gene Product Result for
Synonyms: Ctb9 KLHDC5
UniProtKB ID: Q9P2K6, Q2VPK1, Q8N334
Gene ID:
Mouse(232539) kelch-like 42
Rat(500367) kelch-like family, member 42
Zebrafish(567545) kelch-like family, member 42
domestic guinea pig(100723627) kelch-like family member 42
naked mole-rat(101713974) kelch-like family member 42
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020782 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013571 MISSION® esiRNA esiRNA targeting human KLHDC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020782 Rosetta Predictions human pricing
NM_001109257 Rosetta Predictions rat pricing
NM_001081237 Rosetta Predictions mouse pricing
XM_485838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044079 predicted 2062
2 SASI_Hs01_00044080 predicted 1091
3 SASI_Hs01_00044081 predicted 865
4 SASI_Hs01_00044082 predicted 939
5 SASI_Hs01_00044083 predicted 850
6 SASI_Hs01_00044084 predicted 2070
7 SASI_Hs01_00044085 predicted 521
8 SASI_Hs01_00044086 predicted 721
9 SASI_Hs01_00044087 predicted 1136
10 SASI_Hs01_00044088 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246634 predicted 959
2 SASI_Rn02_00246635 predicted 1606
3 SASI_Rn02_00246636 predicted 1711
4 SASI_Rn02_00246637 predicted 1344
5 SASI_Rn02_00246638 predicted 877
6 SASI_Rn02_00246639 predicted 459
7 SASI_Rn02_00246640 predicted 1076
8 SASI_Rn02_00246641 predicted 1522
9 SASI_Rn02_00246642 predicted 1491
10 SASI_Rn02_00246643 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296517 predicted 1369
2 SASI_Mm02_00296518 predicted 1304
3 SASI_Mm02_00296519 predicted 801
4 SASI_Mm02_00296520 predicted 1757
5 SASI_Mm02_00296521 predicted 714
6 SASI_Mm02_00296522 predicted 1287
7 SASI_Mm02_00296523 predicted 1446
8 SASI_Mm02_00296524 predicted 1874
9 SASI_Mm02_00296525 predicted 1810
10 SASI_Mm02_00296526 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235061 predicted 1374
2 SASI_Mm01_00235062 predicted 1312
3 SASI_Mm01_00235063 predicted 800
4 SASI_Mm01_00235064 predicted 1765
5 SASI_Mm01_00235065 predicted 714
6 SASI_Mm01_00235066 predicted 1288
7 SASI_Mm01_00235067 predicted 1460
8 SASI_Mm01_00235068 predicted 1880
9 SASI_Mm01_00235069 predicted 1815
10 SASI_Mm01_00235070 predicted 869
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020782
VALIDATED
KLHL42 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 42
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020782.1-2240s1c1
Sequence:CCGGGCAGTTACAAATGCTGGATAACTCGAGTTATCCAGCATTTGTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020782.1-1543s1c1
Sequence:CCGGGACATAACTTGCTGGTTTCTTCTCGAGAAGAAACCAGCAAGTTATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020782.1-1007s1c1
Sequence:CCGGCGTTTCTAACGTTGAGTGTTACTCGAGTAACACTCAACGTTAGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020782.1-938s1c1
Sequence:CCGGGAACCAGAAGAGGTCTAACTTCTCGAGAAGTTAGACCTCTTCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020782.1-3278s1c1
Sequence:CCGGCCTCTAGTCTACTTACAACTTCTCGAGAAGTTGTAAGTAGACTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020782.1-1141s1c1
Sequence:CCGGGAGACCGGAACATGAACATTTCTCGAGAAATGTTCATGTTCCGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020782.1-1193s1c1
Sequence:CCGGGCTCTTTGAAACATGTGACGTCTCGAGACGTCACATGTTTCAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020782.1-941s1c1
Sequence:CCGGCCAGAAGAGGTCTAACTTCAACTCGAGTTGAAGTTAGACCTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020782.1-1379s1c1
Sequence:CCGGCACGTCCAAATCGGGTCTTAACTCGAGTTAAGACCCGATTTGGACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1401s21c1
Sequence:CCGGTTGACTTGTGCGCTCCATAACCTCGAGGTTATGGAGCGCACAAGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020782.1-1669s21c1
Sequence:CCGGACCAATTCCTAAAGGGTAAAGCTCGAGCTTTACCCTTTAGGAATTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1594s21c1
Sequence:CCGGGACTGAATTGAATTGGTAGATCTCGAGATCTACCAATTCAATTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-146s21c1
Sequence:CCGGCATCGAGCAGAGCGACTACTTCTCGAGAAGTAGTCGCTCTGCTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1504s21c1
Sequence:CCGGCAGATAGTTGGGAAGCATTTCCTCGAGGAAATGCTTCCCAACTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1034s21c1
Sequence:CCGGCGAGCAGGATGCGTGGAATTTCTCGAGAAATTCCACGCATCCTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1119s21c1
Sequence:CCGGGTCATTGGAGGATACACTACCCTCGAGGGTAGTGTATCCTCCAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020782
VALIDATED
KLHL42 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 42
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020782.1-2240s1c1
Sequence:CCGGGCAGTTACAAATGCTGGATAACTCGAGTTATCCAGCATTTGTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020782.1-1543s1c1
Sequence:CCGGGACATAACTTGCTGGTTTCTTCTCGAGAAGAAACCAGCAAGTTATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020782.1-1007s1c1
Sequence:CCGGCGTTTCTAACGTTGAGTGTTACTCGAGTAACACTCAACGTTAGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020782.1-938s1c1
Sequence:CCGGGAACCAGAAGAGGTCTAACTTCTCGAGAAGTTAGACCTCTTCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020782.1-3278s1c1
Sequence:CCGGCCTCTAGTCTACTTACAACTTCTCGAGAAGTTGTAAGTAGACTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020782.1-1141s1c1
Sequence:CCGGGAGACCGGAACATGAACATTTCTCGAGAAATGTTCATGTTCCGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020782.1-1193s1c1
Sequence:CCGGGCTCTTTGAAACATGTGACGTCTCGAGACGTCACATGTTTCAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020782.1-941s1c1
Sequence:CCGGCCAGAAGAGGTCTAACTTCAACTCGAGTTGAAGTTAGACCTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020782.1-1379s1c1
Sequence:CCGGCACGTCCAAATCGGGTCTTAACTCGAGTTAAGACCCGATTTGGACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1401s21c1
Sequence:CCGGTTGACTTGTGCGCTCCATAACCTCGAGGTTATGGAGCGCACAAGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020782.1-1669s21c1
Sequence:CCGGACCAATTCCTAAAGGGTAAAGCTCGAGCTTTACCCTTTAGGAATTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1594s21c1
Sequence:CCGGGACTGAATTGAATTGGTAGATCTCGAGATCTACCAATTCAATTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-146s21c1
Sequence:CCGGCATCGAGCAGAGCGACTACTTCTCGAGAAGTAGTCGCTCTGCTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1504s21c1
Sequence:CCGGCAGATAGTTGGGAAGCATTTCCTCGAGGAAATGCTTCCCAACTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1034s21c1
Sequence:CCGGCGAGCAGGATGCGTGGAATTTCTCGAGAAATTCCACGCATCCTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1119s21c1
Sequence:CCGGGTCATTGGAGGATACACTACCCTCGAGGGTAGTGTATCCTCCAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020782
VALIDATED
KLHL42 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 42
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020782.1-2240s1c1
Sequence:CCGGGCAGTTACAAATGCTGGATAACTCGAGTTATCCAGCATTTGTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020782.1-1543s1c1
Sequence:CCGGGACATAACTTGCTGGTTTCTTCTCGAGAAGAAACCAGCAAGTTATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020782.1-1007s1c1
Sequence:CCGGCGTTTCTAACGTTGAGTGTTACTCGAGTAACACTCAACGTTAGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020782.1-938s1c1
Sequence:CCGGGAACCAGAAGAGGTCTAACTTCTCGAGAAGTTAGACCTCTTCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020782.1-3278s1c1
Sequence:CCGGCCTCTAGTCTACTTACAACTTCTCGAGAAGTTGTAAGTAGACTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020782.1-1141s1c1
Sequence:CCGGGAGACCGGAACATGAACATTTCTCGAGAAATGTTCATGTTCCGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020782.1-1193s1c1
Sequence:CCGGGCTCTTTGAAACATGTGACGTCTCGAGACGTCACATGTTTCAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020782.1-941s1c1
Sequence:CCGGCCAGAAGAGGTCTAACTTCAACTCGAGTTGAAGTTAGACCTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020782.1-1379s1c1
Sequence:CCGGCACGTCCAAATCGGGTCTTAACTCGAGTTAAGACCCGATTTGGACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1401s21c1
Sequence:CCGGTTGACTTGTGCGCTCCATAACCTCGAGGTTATGGAGCGCACAAGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020782.1-1669s21c1
Sequence:CCGGACCAATTCCTAAAGGGTAAAGCTCGAGCTTTACCCTTTAGGAATTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1594s21c1
Sequence:CCGGGACTGAATTGAATTGGTAGATCTCGAGATCTACCAATTCAATTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-146s21c1
Sequence:CCGGCATCGAGCAGAGCGACTACTTCTCGAGAAGTAGTCGCTCTGCTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1504s21c1
Sequence:CCGGCAGATAGTTGGGAAGCATTTCCTCGAGGAAATGCTTCCCAACTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1034s21c1
Sequence:CCGGCGAGCAGGATGCGTGGAATTTCTCGAGAAATTCCACGCATCCTGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020782.1-1119s21c1
Sequence:CCGGGTCATTGGAGGATACACTACCCTCGAGGGTAGTGTATCCTCCAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081237
VALIDATED
KLHL42 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 42
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081237.1-1936s21c1
Sequence:CCGGCTGACTGATTCAACGGTATTTCTCGAGAAATACCGTTGAATCAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081237.1-1459s21c1
Sequence:CCGGTTACGTCATTGGCGGATATACCTCGAGGTATATCCGCCAATGACGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081237.1-4915s21c1
Sequence:CCGGCGCATACGGCTTAGGATTAAGCTCGAGCTTAATCCTAAGCCGTATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081237.1-1356s21c1
Sequence:CCGGCTAACGTGGAATGCTACAATCCTCGAGGATTGTAGCATTCCACGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081237.1-1378s21c1
Sequence:CCGGCGAGCAAGATGCGTGGAATTTCTCGAGAAATTCCACGCATCTTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081237
VALIDATED
KLHL42 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 42
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081237.1-1936s21c1
Sequence:CCGGCTGACTGATTCAACGGTATTTCTCGAGAAATACCGTTGAATCAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081237.1-1459s21c1
Sequence:CCGGTTACGTCATTGGCGGATATACCTCGAGGTATATCCGCCAATGACGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081237.1-4915s21c1
Sequence:CCGGCGCATACGGCTTAGGATTAAGCTCGAGCTTAATCCTAAGCCGTATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081237.1-1356s21c1
Sequence:CCGGCTAACGTGGAATGCTACAATCCTCGAGGATTGTAGCATTCCACGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081237.1-1378s21c1
Sequence:CCGGCGAGCAAGATGCGTGGAATTTCTCGAGAAATTCCACGCATCTTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081237
VALIDATED
KLHL42 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 42
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081237.1-1936s21c1
Sequence:CCGGCTGACTGATTCAACGGTATTTCTCGAGAAATACCGTTGAATCAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081237.1-1459s21c1
Sequence:CCGGTTACGTCATTGGCGGATATACCTCGAGGTATATCCGCCAATGACGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081237.1-4915s21c1
Sequence:CCGGCGCATACGGCTTAGGATTAAGCTCGAGCTTAATCCTAAGCCGTATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081237.1-1356s21c1
Sequence:CCGGCTAACGTGGAATGCTACAATCCTCGAGGATTGTAGCATTCCACGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081237.1-1378s21c1
Sequence:CCGGCGAGCAAGATGCGTGGAATTTCTCGAGAAATTCCACGCATCTTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)