EMAIL THIS PAGE TO A FRIEND

KLHL4

kelch-like family member 4

161 Gene Product Result for
Synonyms: DKELCHL KHL4
UniProtKB ID: Q9C0H6, B2RTW2, Q9Y3J5
Gene ID:
Human(56062) Summary: This gene encodes a member of the kelch family of proteins, which are characterized by kelch repeat motifs and a POZ/BTB protein-binding domain. It is thought that kelch repeats are actin binding domains. However, the specific function of this protein has not been determined. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(237010) kelch-like 4
Rat(317196) kelch-like family member 4
domestic guinea pig(100727502) kelch-like family member 4
naked mole-rat(101726511) kelch-like family member 4
sheep(101108287) kelch-like 4 (Drosophila)
chicken(422265) kelch-like 4 (Drosophila)
cow(526880) kelch-like 4
Horse(100071689) kelch-like 4 (Drosophila)
dog(491999) kelch-like 4 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019117 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019117 Rosetta Predictions human pricing
NM_057162 Rosetta Predictions human pricing
NM_001108244 Rosetta Predictions rat pricing
NM_172781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088374 predicted 1675
2 SASI_Hs01_00088376 predicted 1325
3 SASI_Hs01_00088377 predicted 929
4 SASI_Hs02_00352744 predicted 1645
5 SASI_Hs01_00088379 predicted 1394
6 SASI_Hs01_00088380 predicted 1481
7 SASI_Hs01_00088381 predicted 1463
8 SASI_Hs01_00088382 predicted 1500
9 SASI_Hs02_00352745 predicted 992
10 SASI_Hs02_00352746 predicted 799
11 SASI_Hs01_00088375 predicted 1690
12 SASI_Hs01_00088378 predicted 1933
13 SASI_Hs01_00088383 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196711 predicted 1674
2 SASI_Hs01_00196713 predicted 1324
3 SASI_Hs01_00196714 predicted 936
4 SASI_Hs02_00362018 predicted 1645
5 SASI_Hs01_00196716 predicted 1394
6 SASI_Hs01_00196717 predicted 1480
7 SASI_Hs01_00196718 predicted 1471
8 SASI_Hs01_00196719 predicted 1499
9 SASI_Hs02_00362019 predicted 991
10 SASI_Hs02_00362020 predicted 794
11 SASI_Hs01_00196712 predicted 1696
12 SASI_Hs01_00196715 predicted 1938
13 SASI_Hs01_00196720 predicted 1294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236744 predicted 648
2 SASI_Rn02_00236745 predicted 280
3 SASI_Rn02_00236746 predicted 1235
4 SASI_Rn02_00236747 predicted 913
5 SASI_Rn02_00236748 predicted 1687
6 SASI_Rn02_00236749 predicted 672
7 SASI_Rn02_00236750 predicted 1596
8 SASI_Rn02_00236751 predicted 1497
9 SASI_Rn02_00236752 predicted 1673
10 SASI_Rn02_00236753 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081738 predicted 1488
2 SASI_Mm01_00081739 predicted 1547
3 SASI_Mm01_00081740 predicted 1138
4 SASI_Mm01_00081741 predicted 1576
5 SASI_Mm01_00081742 predicted 1375
6 SASI_Mm01_00081744 predicted 1503
7 SASI_Mm01_00081746 predicted 607
8 SASI_Mm01_00081747 predicted 1409
9 SASI_Mm02_00344675 predicted 392
10 SASI_Mm02_00344676 predicted 1656
11 SASI_Mm01_00081743 predicted 2155
12 SASI_Mm01_00081745 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172781
KLHL4 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1155s1c1
Sequence:CCGGCCCTCGTACAAAGCCTAGAAACTCGAGTTTCTAGGCTTTGTACGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172781.1-2840s1c1
Sequence:CCGGCCATGTAAACACCTTCCATTACTCGAGTAATGGAAGGTGTTTACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1928s1c1
Sequence:CCGGGCGGATATGATGGTCATACTTCTCGAGAAGTATGACCATCATATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1929s1c1
Sequence:CCGGCGGATATGATGGTCATACTTACTCGAGTAAGTATGACCATCATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1600s1c1
Sequence:CCGGGCATTAAACAATAGGCTGTATCTCGAGATACAGCCTATTGTTTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172781
KLHL4 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1155s1c1
Sequence:CCGGCCCTCGTACAAAGCCTAGAAACTCGAGTTTCTAGGCTTTGTACGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172781.1-2840s1c1
Sequence:CCGGCCATGTAAACACCTTCCATTACTCGAGTAATGGAAGGTGTTTACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1928s1c1
Sequence:CCGGGCGGATATGATGGTCATACTTCTCGAGAAGTATGACCATCATATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1929s1c1
Sequence:CCGGCGGATATGATGGTCATACTTACTCGAGTAAGTATGACCATCATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1600s1c1
Sequence:CCGGGCATTAAACAATAGGCTGTATCTCGAGATACAGCCTATTGTTTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172781
KLHL4 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1155s1c1
Sequence:CCGGCCCTCGTACAAAGCCTAGAAACTCGAGTTTCTAGGCTTTGTACGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172781.1-2840s1c1
Sequence:CCGGCCATGTAAACACCTTCCATTACTCGAGTAATGGAAGGTGTTTACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1928s1c1
Sequence:CCGGGCGGATATGATGGTCATACTTCTCGAGAAGTATGACCATCATATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1929s1c1
Sequence:CCGGCGGATATGATGGTCATACTTACTCGAGTAAGTATGACCATCATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172781.1-1600s1c1
Sequence:CCGGGCATTAAACAATAGGCTGTATCTCGAGATACAGCCTATTGTTTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019117
KLHL4 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-1316s1c1
Sequence:CCGGGCCTGAGAGAAGATCCATGATCTCGAGATCATGGATCTTCTCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-1927s1c1
Sequence:CCGGCCACATACAATGGATTCTTATCTCGAGATAAGAATCCATTGTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-1834s1c1
Sequence:CCGGCCTGCCTCAAATCAATGGAATCTCGAGATTCCATTGATTTGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-581s1c1
Sequence:CCGGCGCAGAGCAAACTCTTCGTAACTCGAGTTACGAAGAGTTTGCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019117.3-2714s1c1
Sequence:CCGGGCCATTATTCTCCTATTCAAACTCGAGTTTGAATAGGAGAATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019117
KLHL4 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-1316s1c1
Sequence:CCGGGCCTGAGAGAAGATCCATGATCTCGAGATCATGGATCTTCTCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-1927s1c1
Sequence:CCGGCCACATACAATGGATTCTTATCTCGAGATAAGAATCCATTGTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-1834s1c1
Sequence:CCGGCCTGCCTCAAATCAATGGAATCTCGAGATTCCATTGATTTGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-581s1c1
Sequence:CCGGCGCAGAGCAAACTCTTCGTAACTCGAGTTACGAAGAGTTTGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019117.3-2714s1c1
Sequence:CCGGGCCATTATTCTCCTATTCAAACTCGAGTTTGAATAGGAGAATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019117
KLHL4 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-1316s1c1
Sequence:CCGGGCCTGAGAGAAGATCCATGATCTCGAGATCATGGATCTTCTCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-1927s1c1
Sequence:CCGGCCACATACAATGGATTCTTATCTCGAGATAAGAATCCATTGTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-1834s1c1
Sequence:CCGGCCTGCCTCAAATCAATGGAATCTCGAGATTCCATTGATTTGAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019117.3-581s1c1
Sequence:CCGGCGCAGAGCAAACTCTTCGTAACTCGAGTTACGAAGAGTTTGCTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019117.3-2714s1c1
Sequence:CCGGGCCATTATTCTCCTATTCAAACTCGAGTTTGAATAGGAGAATAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)