EMAIL THIS PAGE TO A FRIEND

KLHL5

kelch-like family member 5

104 Gene Product Result for
Gene ID:
Mouse(71778) kelch-like 5
Rat(305351) kelch-like family member 5
domestic guinea pig(100714214) kelch-like family member 5
naked mole-rat(101719828) kelch-like family member 5
sheep(101112731) kelch-like 5 (Drosophila)
Domestic Rabbit(100354258) kelch-like 5 (Drosophila)
Zebrafish(560697) kelch-like 5 (Drosophila)
cow(528668) kelch-like family member 5
Horse(100064472) kelch-like 5 (Drosophila)
domestic cat(101094594) kelch-like 5 (Drosophila)
dog(612886) kelch-like 5 (Drosophila)
chicken(425121) kelch-like 5 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA013958 Anti-KLHL5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV34786 Anti-KLHL5 antibody produced in rabbit IgG fraction of antiserum guinea pig, mouse, canine, horse, rat, human
western blot pricing
SAB2104473 Anti-KLHL5 antibody produced in rabbit affinity isolated antibody , mouse, zebrafish, rat, human, rabbit, guinea pig, bovine, horse
western blot pricing
SAB2103001 Anti-KLHL5, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, guinea pig, human, mouse, rat, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007075 Rosetta Predictions human pricing
NM_015990 Rosetta Predictions human pricing
NM_199039 Rosetta Predictions human pricing
NM_001047093 Rosetta Predictions rat pricing
NM_175174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157151 predicted 1021
2 SASI_Hs01_00157152 predicted 1154
3 SASI_Hs01_00157153 predicted 1865
4 SASI_Hs01_00157154 predicted 1859
5 SASI_Hs01_00157155 predicted 1143
6 SASI_Hs01_00157156 predicted 918
7 SASI_Hs01_00157157 predicted 1319
8 SASI_Hs01_00157158 predicted 1968
9 SASI_Hs01_00157160 predicted 1798
10 SASI_Hs02_00305215 predicted 1694
11 SASI_Hs01_00157159 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024617 predicted 1085
2 SASI_Hs01_00024618 predicted 1209
3 SASI_Hs01_00024619 predicted 1924
4 SASI_Hs01_00024620 predicted 1917
5 SASI_Hs01_00024621 predicted 1203
6 SASI_Hs01_00024622 predicted 979
7 SASI_Hs01_00024623 predicted 1382
8 SASI_Hs01_00024624 predicted 2025
9 SASI_Hs01_00024626 predicted 1868
10 SASI_Hs02_00348669 predicted 1757
11 SASI_Hs01_00024625 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240286 predicted 900
2 SASI_Hs01_00240287 predicted 1027
3 SASI_Hs01_00240288 predicted 1745
4 SASI_Hs01_00240289 predicted 1736
5 SASI_Hs01_00240290 predicted 1015
6 SASI_Hs01_00240291 predicted 798
7 SASI_Hs01_00240292 predicted 1192
8 SASI_Hs01_00240293 predicted 1845
9 SASI_Hs01_00240295 predicted 1685
10 SASI_Hs02_00372524 predicted 1574
11 SASI_Hs01_00240294 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205864 predicted 1211
2 SASI_Rn02_00205865 predicted 1076
3 SASI_Rn02_00205866 predicted 652
4 SASI_Rn02_00205867 predicted 840
5 SASI_Rn02_00205868 predicted 390
6 SASI_Rn02_00205869 predicted 1046
7 SASI_Rn02_00205870 predicted 1033
8 SASI_Rn02_00205871 predicted 1079
9 SASI_Rn02_00205872 predicted 1390
10 SASI_Rn02_00205873 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345810 predicted 1339
2 SASI_Mm02_00345811 predicted 592
3 SASI_Mm01_00129408 predicted 824
4 SASI_Mm02_00345812 predicted 391
5 SASI_Mm02_00345813 predicted 2349
6 SASI_Mm02_00345814 predicted 1821
7 SASI_Mm02_00345815 predicted 1395
8 SASI_Mm02_00345816 predicted 2373
9 SASI_Mm01_00129413 predicted 1039
10 SASI_Mm02_00345817 predicted 1331
11 SASI_Mm01_00129407 predicted 675
12 SASI_Mm01_00129409 predicted 383
13 SASI_Mm01_00129410 predicted 1294
14 SASI_Mm01_00129411 predicted 587
15 SASI_Mm01_00129412 predicted 1296
16 SASI_Mm01_00129414 predicted 1292
17 SASI_Mm01_00129415 predicted 621
18 SASI_Mm01_00129416 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007075
VALIDATED
KLHL5 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-1609s21c1
Sequence:CCGGAGTCAACTGTTGGTACATTATCTCGAGATAATGTACCAACAGTTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-1413s21c1
Sequence:CCGGAGACGGAAAGATCTAAGTAAACTCGAGTTTACTTAGATCTTTCCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-521s21c1
Sequence:CCGGAGATCCATGTAGCCTACAATTCTCGAGAATTGTAGGCTACATGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-1300s21c1
Sequence:CCGGTATTACCAGCCAGCGAAATTGCTCGAGCAATTTCGCTGGCTGGTAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007075.1-3180s1c1
Sequence:CCGGCCTGCCTTATTTCTTATGTTTCTCGAGAAACATAAGAAATAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007075.1-1873s1c1
Sequence:CCGGCTTGTCTCAAATCAGTAGAATCTCGAGATTCTACTGATTTGAGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007075.1-610s1c1
Sequence:CCGGCCCTTAATCATGCCGAGCAAACTCGAGTTTGCTCGGCATGATTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007075.1-1125s1c1
Sequence:CCGGGCTAGTGATGACATGAACATTCTCGAGAATGTTCATGTCATCACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007075.1-541s1c1
Sequence:CCGGCCAATAGTAGTCAGACATTATCTCGAGATAATGTCTGACTACTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007075
VALIDATED
KLHL5 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-1609s21c1
Sequence:CCGGAGTCAACTGTTGGTACATTATCTCGAGATAATGTACCAACAGTTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-1413s21c1
Sequence:CCGGAGACGGAAAGATCTAAGTAAACTCGAGTTTACTTAGATCTTTCCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-521s21c1
Sequence:CCGGAGATCCATGTAGCCTACAATTCTCGAGAATTGTAGGCTACATGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-1300s21c1
Sequence:CCGGTATTACCAGCCAGCGAAATTGCTCGAGCAATTTCGCTGGCTGGTAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007075.1-3180s1c1
Sequence:CCGGCCTGCCTTATTTCTTATGTTTCTCGAGAAACATAAGAAATAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007075.1-1873s1c1
Sequence:CCGGCTTGTCTCAAATCAGTAGAATCTCGAGATTCTACTGATTTGAGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007075.1-610s1c1
Sequence:CCGGCCCTTAATCATGCCGAGCAAACTCGAGTTTGCTCGGCATGATTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007075.1-1125s1c1
Sequence:CCGGGCTAGTGATGACATGAACATTCTCGAGAATGTTCATGTCATCACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007075.1-541s1c1
Sequence:CCGGCCAATAGTAGTCAGACATTATCTCGAGATAATGTCTGACTACTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007075
VALIDATED
KLHL5 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-1609s21c1
Sequence:CCGGAGTCAACTGTTGGTACATTATCTCGAGATAATGTACCAACAGTTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-1413s21c1
Sequence:CCGGAGACGGAAAGATCTAAGTAAACTCGAGTTTACTTAGATCTTTCCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-521s21c1
Sequence:CCGGAGATCCATGTAGCCTACAATTCTCGAGAATTGTAGGCTACATGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007075.2-1300s21c1
Sequence:CCGGTATTACCAGCCAGCGAAATTGCTCGAGCAATTTCGCTGGCTGGTAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007075.1-3180s1c1
Sequence:CCGGCCTGCCTTATTTCTTATGTTTCTCGAGAAACATAAGAAATAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007075.1-1873s1c1
Sequence:CCGGCTTGTCTCAAATCAGTAGAATCTCGAGATTCTACTGATTTGAGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007075.1-610s1c1
Sequence:CCGGCCCTTAATCATGCCGAGCAAACTCGAGTTTGCTCGGCATGATTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007075.1-1125s1c1
Sequence:CCGGGCTAGTGATGACATGAACATTCTCGAGAATGTTCATGTCATCACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007075.1-541s1c1
Sequence:CCGGCCAATAGTAGTCAGACATTATCTCGAGATAATGTCTGACTACTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175174
VALIDATED
KLHL5 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175174.2-972s1c1
Sequence:CCGGCCGTGTATATTTGTGTTGTATCTCGAGATACAACACAAATATACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175174.2-181s1c1
Sequence:CCGGCCCTTAACCATGCAGAGCAAACTCGAGTTTGCTCTGCATGGTTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175174.2-308s1c1
Sequence:CCGGCTCAGATTATTTCGCTGCTATCTCGAGATAGCAGCGAAATAATCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175174.2-780s1c1
Sequence:CCGGCGGAAGGATCTCAGTAGACTTCTCGAGAAGTCTACTGAGATCCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175174.2-606s1c1
Sequence:CCGGGCTCACAATTACACGATGGAACTCGAGTTCCATCGTGTAATTGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175174
VALIDATED
KLHL5 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175174.2-972s1c1
Sequence:CCGGCCGTGTATATTTGTGTTGTATCTCGAGATACAACACAAATATACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175174.2-181s1c1
Sequence:CCGGCCCTTAACCATGCAGAGCAAACTCGAGTTTGCTCTGCATGGTTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175174.2-308s1c1
Sequence:CCGGCTCAGATTATTTCGCTGCTATCTCGAGATAGCAGCGAAATAATCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175174.2-780s1c1
Sequence:CCGGCGGAAGGATCTCAGTAGACTTCTCGAGAAGTCTACTGAGATCCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175174.2-606s1c1
Sequence:CCGGGCTCACAATTACACGATGGAACTCGAGTTCCATCGTGTAATTGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175174
VALIDATED
KLHL5 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175174.2-972s1c1
Sequence:CCGGCCGTGTATATTTGTGTTGTATCTCGAGATACAACACAAATATACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175174.2-181s1c1
Sequence:CCGGCCCTTAACCATGCAGAGCAAACTCGAGTTTGCTCTGCATGGTTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175174.2-308s1c1
Sequence:CCGGCTCAGATTATTTCGCTGCTATCTCGAGATAGCAGCGAAATAATCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175174.2-780s1c1
Sequence:CCGGCGGAAGGATCTCAGTAGACTTCTCGAGAAGTCTACTGAGATCCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175174.2-606s1c1
Sequence:CCGGGCTCACAATTACACGATGGAACTCGAGTTCCATCGTGTAATTGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)