EMAIL THIS PAGE TO A FRIEND

KLHL6

kelch-like family member 6

244 Gene Product Result for
UniProtKB ID: Q8WZ60, B2RB31, D3DNS8, Q8N5I1, Q8N892
Gene ID:
Mouse(239743) kelch-like 6
Rat(287974) kelch-like family member 6
Zebrafish(368818) kelch-like 6 (Drosophila)
dog(488096) kelch-like 6 (Drosophila)
Horse(100058733) kelch-like 6 (Drosophila)
cow(527363) kelch-like 6 (Drosophila)
domestic cat(101092207) kelch-like 6 (Drosophila)
chicken(424762) kelch-like 6 (Drosophila)
sheep(101102950) kelch-like 6 (Drosophila)
naked mole-rat(101722339) kelch-like family member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_130446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130446 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043201 MISSION® esiRNA esiRNA human KLHL6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130446 Rosetta Predictions human pricing
NM_001105867 Rosetta Predictions rat pricing
NM_183390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362746 predicted 1041
2 SASI_Hs01_00156042 predicted 1185
3 SASI_Hs01_00156043 predicted 1586
4 SASI_Hs01_00156044 predicted 1724
5 SASI_Hs01_00156045 predicted 955
6 SASI_Hs02_00362747 predicted 1513
7 SASI_Hs01_00156046 predicted 426
8 SASI_Hs02_00362748 predicted 214
9 SASI_Hs01_00156047 predicted 1156
10 SASI_Hs01_00156048 predicted 635
11 SASI_Hs01_00156040 predicted 1181
12 SASI_Hs01_00156041 predicted 669
13 SASI_Hs01_00156049 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213312 predicted 590
2 SASI_Rn02_00213313 predicted 343
3 SASI_Rn02_00213314 predicted 929
4 SASI_Rn02_00213315 predicted 1187
5 SASI_Rn02_00213316 predicted 1702
6 SASI_Rn02_00213317 predicted 1252
7 SASI_Rn02_00213318 predicted 1310
8 SASI_Rn02_00213319 predicted 720
9 SASI_Rn02_00213320 predicted 511
10 SASI_Rn02_00213321 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074420 predicted 1101
2 SASI_Mm01_00074421 predicted 1424
3 SASI_Mm01_00074422 predicted 936
4 SASI_Mm02_00350501 predicted 290
5 SASI_Mm01_00074423 predicted 1116
6 SASI_Mm01_00074424 predicted 735
7 SASI_Mm02_00350502 predicted 665
8 SASI_Mm02_00350503 predicted 785
9 SASI_Mm01_00074426 predicted 1479
10 SASI_Mm01_00074427 predicted 1633
11 SASI_Mm01_00074425 predicted 300
12 SASI_Mm01_00074428 predicted 747
13 SASI_Mm01_00074429 predicted 1224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183390
KLHL6 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183390.1-2035s1c1
Sequence:CCGGGCCAGACACTTACCCATTGTACTCGAGTACAATGGGTAAGTGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183390.1-541s1c1
Sequence:CCGGGCAAGTCCAAAGTTGCATCATCTCGAGATGATGCAACTTTGGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-264s21c1
Sequence:CCGGCCATGTTCTGCAACGACTTAACTCGAGTTAAGTCGTTGCAGAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-1168s21c1
Sequence:CCGGATGGATTCAGATCGAATATTTCTCGAGAAATATTCGATCTGAATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-291s21c1
Sequence:CCGGAGTATGAGAAGAGGATCATTACTCGAGTAATGATCCTCTTCTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183390.1-1842s21c1
Sequence:CCGGTGGAGTCTCTGAGCACCTATACTCGAGTATAGGTGCTCAGAGACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183390.1-292s1c1
Sequence:CCGGGTATGAGAAGAGGATCATTATCTCGAGATAATGATCCTCTTCTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-1542s21c1
Sequence:CCGGTGAGAGCACTCTACGCTTATACTCGAGTATAAGCGTAGAGTGCTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183390
KLHL6 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183390.1-2035s1c1
Sequence:CCGGGCCAGACACTTACCCATTGTACTCGAGTACAATGGGTAAGTGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183390.1-541s1c1
Sequence:CCGGGCAAGTCCAAAGTTGCATCATCTCGAGATGATGCAACTTTGGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-264s21c1
Sequence:CCGGCCATGTTCTGCAACGACTTAACTCGAGTTAAGTCGTTGCAGAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-1168s21c1
Sequence:CCGGATGGATTCAGATCGAATATTTCTCGAGAAATATTCGATCTGAATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-291s21c1
Sequence:CCGGAGTATGAGAAGAGGATCATTACTCGAGTAATGATCCTCTTCTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183390.1-1842s21c1
Sequence:CCGGTGGAGTCTCTGAGCACCTATACTCGAGTATAGGTGCTCAGAGACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183390.1-292s1c1
Sequence:CCGGGTATGAGAAGAGGATCATTATCTCGAGATAATGATCCTCTTCTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-1542s21c1
Sequence:CCGGTGAGAGCACTCTACGCTTATACTCGAGTATAAGCGTAGAGTGCTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183390
KLHL6 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183390.1-2035s1c1
Sequence:CCGGGCCAGACACTTACCCATTGTACTCGAGTACAATGGGTAAGTGTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183390.1-541s1c1
Sequence:CCGGGCAAGTCCAAAGTTGCATCATCTCGAGATGATGCAACTTTGGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-264s21c1
Sequence:CCGGCCATGTTCTGCAACGACTTAACTCGAGTTAAGTCGTTGCAGAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-1168s21c1
Sequence:CCGGATGGATTCAGATCGAATATTTCTCGAGAAATATTCGATCTGAATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-291s21c1
Sequence:CCGGAGTATGAGAAGAGGATCATTACTCGAGTAATGATCCTCTTCTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183390.1-1842s21c1
Sequence:CCGGTGGAGTCTCTGAGCACCTATACTCGAGTATAGGTGCTCAGAGACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183390.1-292s1c1
Sequence:CCGGGTATGAGAAGAGGATCATTATCTCGAGATAATGATCCTCTTCTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183390.1-1542s21c1
Sequence:CCGGTGAGAGCACTCTACGCTTATACTCGAGTATAAGCGTAGAGTGCTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130446
KLHL6 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-709s1c1
Sequence:CCGGCCATCAGAACGACTCTGCTTACTCGAGTAAGCAGAGTCGTTCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-1161s1c1
Sequence:CCGGGATCAACAAGTGGATTCAGATCTCGAGATCTGAATCCACTTGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-547s1c1
Sequence:CCGGGTTCAGAGTTACATCATTCAACTCGAGTTGAATGATGTAACTCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130446.1-4632s1c1
Sequence:CCGGGCAAGGAACTAAGGAAGGAATCTCGAGATTCCTTCCTTAGTTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130446.1-2535s1c1
Sequence:CCGGGCCAGACAGAATTGTACCTTTCTCGAGAAAGGTACAATTCTGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-1260s1c1
Sequence:CCGGCGGCTTACAGAGAATCAACAACTCGAGTTGTTGATTCTCTGTAAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130446
KLHL6 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-709s1c1
Sequence:CCGGCCATCAGAACGACTCTGCTTACTCGAGTAAGCAGAGTCGTTCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-1161s1c1
Sequence:CCGGGATCAACAAGTGGATTCAGATCTCGAGATCTGAATCCACTTGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-547s1c1
Sequence:CCGGGTTCAGAGTTACATCATTCAACTCGAGTTGAATGATGTAACTCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130446.1-4632s1c1
Sequence:CCGGGCAAGGAACTAAGGAAGGAATCTCGAGATTCCTTCCTTAGTTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130446.1-2535s1c1
Sequence:CCGGGCCAGACAGAATTGTACCTTTCTCGAGAAAGGTACAATTCTGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-1260s1c1
Sequence:CCGGCGGCTTACAGAGAATCAACAACTCGAGTTGTTGATTCTCTGTAAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130446
KLHL6 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-709s1c1
Sequence:CCGGCCATCAGAACGACTCTGCTTACTCGAGTAAGCAGAGTCGTTCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-1161s1c1
Sequence:CCGGGATCAACAAGTGGATTCAGATCTCGAGATCTGAATCCACTTGTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-547s1c1
Sequence:CCGGGTTCAGAGTTACATCATTCAACTCGAGTTGAATGATGTAACTCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130446.1-4632s1c1
Sequence:CCGGGCAAGGAACTAAGGAAGGAATCTCGAGATTCCTTCCTTAGTTCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130446.1-2535s1c1
Sequence:CCGGGCCAGACAGAATTGTACCTTTCTCGAGAAAGGTACAATTCTGTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130446.1-1260s1c1
Sequence:CCGGCGGCTTACAGAGAATCAACAACTCGAGTTGTTGATTCTCTGTAAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)