EMAIL THIS PAGE TO A FRIEND

KLHL7

kelch-like family member 7

154 Gene Product Result for
Synonyms: KLHL6 SBBI26
Gene ID:
Human(55975) Summary: This gene encodes a BTB-Kelch-related protein. The encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. [provided by RefSeq, Feb 2010]
Mouse(52323) kelch-like 7
Rat(362303) kelch-like family member 7
chicken(420612) kelch-like 7 (Drosophila)
cow(534697) kelch-like 7 (Drosophila)
Horse(100053660) kelch-like 7 (Drosophila)
domestic cat(101089000) kelch-like 7 (Drosophila)
dog(475255) kelch-like 7 (Drosophila)
domestic guinea pig(100720424) kelch-like family member 7
naked mole-rat(101697188) kelch-like family member 7
sheep(101109089) kelch-like 7 (Drosophila)
Domestic Rabbit(100338490) kelch-like 7 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018846 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031710 Rosetta Predictions human pricing
NM_018846 Rosetta Predictions human pricing
NM_001012187 Rosetta Predictions rat pricing
XM_575329 Rosetta Predictions rat pricing
NM_026448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215198 predicted 1829
2 SASI_Hs01_00215199 predicted 1705
3 SASI_Hs02_00307728 predicted 788
4 SASI_Hs01_00215201 predicted 1343
5 SASI_Hs01_00215202 predicted 2062
6 SASI_Hs01_00215203 predicted 1175
7 SASI_Hs02_00307729 predicted 730
8 SASI_Hs01_00215205 predicted 941
9 SASI_Hs01_00215206 predicted 1870
10 SASI_Hs02_00307730 predicted 712
11 SASI_Hs01_00215197 predicted 1171
12 SASI_Hs01_00215200 predicted 1931
13 SASI_Hs01_00215204 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352304 predicted 2145
2 SASI_Hs01_00165666 predicted 1355
3 SASI_Hs01_00165667 predicted 1966
4 SASI_Hs02_00352305 predicted 1614
5 SASI_Hs01_00165668 predicted 1827
6 SASI_Hs01_00165670 predicted 1471
7 SASI_Hs01_00165671 predicted 2200
8 SASI_Hs01_00165672 predicted 1302
9 SASI_Hs01_00165675 predicted 2000
10 SASI_Hs02_00352306 predicted 1422
11 SASI_Hs01_00165669 predicted 2076
12 SASI_Hs01_00165673 predicted 1054
13 SASI_Hs01_00165674 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074801 predicted 451
2 SASI_Rn01_00074802 predicted 889
3 SASI_Rn01_00074803 predicted 1817
4 SASI_Rn01_00074805 predicted 932
5 SASI_Rn01_00074807 predicted 257
6 SASI_Rn01_00074809 predicted 437
7 SASI_Rn01_00074810 predicted 758
8 SASI_Rn02_00200401 predicted 1542
9 SASI_Rn02_00200402 predicted 779
10 SASI_Rn02_00200403 predicted 701
11 SASI_Rn01_00074804 predicted 353
12 SASI_Rn01_00074806 predicted 543
13 SASI_Rn01_00074808 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194984 predicted 1039
2 SASI_Rn01_00194985 predicted 1483
3 SASI_Rn01_00194986 predicted 2413
4 SASI_Rn01_00194987 predicted 947
5 SASI_Rn01_00194988 predicted 1517
6 SASI_Rn01_00194989 predicted 1131
7 SASI_Rn01_00194990 predicted 849
8 SASI_Rn01_00194991 predicted 2054
9 SASI_Rn01_00194992 predicted 1034
10 SASI_Rn01_00194993 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162407 predicted 1831
2 SASI_Mm01_00162408 predicted 471
3 SASI_Mm01_00162409 predicted 1933
4 SASI_Mm01_00162410 predicted 881
5 SASI_Mm01_00162411 predicted 562
6 SASI_Mm01_00162412 predicted 1769
7 SASI_Mm02_00330281 predicted 1002
8 SASI_Mm02_00330282 predicted 436
9 SASI_Mm01_00162413 predicted 374
10 SASI_Mm01_00162415 predicted 907
11 SASI_Mm01_00162414 predicted 865
12 SASI_Mm01_00162416 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018846
VALIDATED
KLHL7 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018846.3-1473s21c1
Sequence:CCGGAGCGAATGGACTGCTATAATGCTCGAGCATTATAGCAGTCCATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018846.3-988s21c1
Sequence:CCGGGCGAGTAACACATCTTCTCAACTCGAGTTGAGAAGATGTGTTACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018846.3-2094s21c1
Sequence:CCGGCCAACTCCAAAGTTCGTGCTTCTCGAGAAGCACGAACTTTGGAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018846.3-735s21c1
Sequence:CCGGCTGCTAGAATTTCCGTGAATACTCGAGTATTCACGGAAATTCTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018846.3-2497s21c1
Sequence:CCGGTCATCAGTGAAGCGCAGTATCCTCGAGGATACTGCGCTTCACTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018846.2-2045s1c1
Sequence:CCGGCCAACTCCAAAGTTCGTGCTTCTCGAGAAGCACGAACTTTGGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137015    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018846.2-2460s1c1
Sequence:CCGGCGCAGTATCTTAGCTCTAGATCTCGAGATCTAGAGCTAAGATACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018846.2-2855s1c1
Sequence:CCGGGCCTCTTTAGTCCTCACTGTTCTCGAGAACAGTGAGGACTAAAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018846.2-1592s1c1
Sequence:CCGGGAACTGAAAGCTGGCACACAACTCGAGTTGTGTGCCAGCTTTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018846.2-733s1c1
Sequence:CCGGGCAGCGAACCAATATCAGATTCTCGAGAATCTGATATTGGTTCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018846.2-686s1c1
Sequence:CCGGCTGCTAGAATTTCCGTGAATACTCGAGTATTCACGGAAATTCTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018846.2-939s1c1
Sequence:CCGGGCGAGTAACACATCTTCTCAACTCGAGTTGAGAAGATGTGTTACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018846
VALIDATED
KLHL7 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018846.3-1473s21c1
Sequence:CCGGAGCGAATGGACTGCTATAATGCTCGAGCATTATAGCAGTCCATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018846.3-988s21c1
Sequence:CCGGGCGAGTAACACATCTTCTCAACTCGAGTTGAGAAGATGTGTTACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018846.3-2094s21c1
Sequence:CCGGCCAACTCCAAAGTTCGTGCTTCTCGAGAAGCACGAACTTTGGAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018846.3-735s21c1
Sequence:CCGGCTGCTAGAATTTCCGTGAATACTCGAGTATTCACGGAAATTCTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018846.3-2497s21c1
Sequence:CCGGTCATCAGTGAAGCGCAGTATCCTCGAGGATACTGCGCTTCACTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018846.2-2045s1c1
Sequence:CCGGCCAACTCCAAAGTTCGTGCTTCTCGAGAAGCACGAACTTTGGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137015    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018846.2-2460s1c1
Sequence:CCGGCGCAGTATCTTAGCTCTAGATCTCGAGATCTAGAGCTAAGATACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018846.2-2855s1c1
Sequence:CCGGGCCTCTTTAGTCCTCACTGTTCTCGAGAACAGTGAGGACTAAAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018846.2-1592s1c1
Sequence:CCGGGAACTGAAAGCTGGCACACAACTCGAGTTGTGTGCCAGCTTTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018846.2-733s1c1
Sequence:CCGGGCAGCGAACCAATATCAGATTCTCGAGAATCTGATATTGGTTCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018846.2-686s1c1
Sequence:CCGGCTGCTAGAATTTCCGTGAATACTCGAGTATTCACGGAAATTCTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018846.2-939s1c1
Sequence:CCGGGCGAGTAACACATCTTCTCAACTCGAGTTGAGAAGATGTGTTACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018846
VALIDATED
KLHL7 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018846.3-1473s21c1
Sequence:CCGGAGCGAATGGACTGCTATAATGCTCGAGCATTATAGCAGTCCATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018846.3-988s21c1
Sequence:CCGGGCGAGTAACACATCTTCTCAACTCGAGTTGAGAAGATGTGTTACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018846.3-2094s21c1
Sequence:CCGGCCAACTCCAAAGTTCGTGCTTCTCGAGAAGCACGAACTTTGGAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018846.3-735s21c1
Sequence:CCGGCTGCTAGAATTTCCGTGAATACTCGAGTATTCACGGAAATTCTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018846.3-2497s21c1
Sequence:CCGGTCATCAGTGAAGCGCAGTATCCTCGAGGATACTGCGCTTCACTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018846.2-2045s1c1
Sequence:CCGGCCAACTCCAAAGTTCGTGCTTCTCGAGAAGCACGAACTTTGGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137015    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018846.2-2460s1c1
Sequence:CCGGCGCAGTATCTTAGCTCTAGATCTCGAGATCTAGAGCTAAGATACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018846.2-2855s1c1
Sequence:CCGGGCCTCTTTAGTCCTCACTGTTCTCGAGAACAGTGAGGACTAAAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018846.2-1592s1c1
Sequence:CCGGGAACTGAAAGCTGGCACACAACTCGAGTTGTGTGCCAGCTTTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018846.2-733s1c1
Sequence:CCGGGCAGCGAACCAATATCAGATTCTCGAGAATCTGATATTGGTTCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018846.2-686s1c1
Sequence:CCGGCTGCTAGAATTTCCGTGAATACTCGAGTATTCACGGAAATTCTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018846.2-939s1c1
Sequence:CCGGGCGAGTAACACATCTTCTCAACTCGAGTTGAGAAGATGTGTTACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026448
VALIDATED
KLHL7 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026448.2-811s21c1
Sequence:CCGGCCAGCCATTCATGGTTGATATCTCGAGATATCAACCATGAATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026448.2-2537s21c1
Sequence:CCGGTAAGCTTAGCACCCATCATTACTCGAGTAATGATGGGTGCTAAGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026448.2-409s21c1
Sequence:CCGGAGATGCTGAACCTGATATTATCTCGAGATAATATCAGGTTCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026448.2-1772s21c1
Sequence:CCGGGGGCATATCCTTGAGTATAATCTCGAGATTATACTCAAGGATATGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026448.2-885s21c1
Sequence:CCGGTACAAGCTGAACCACTTATTCCTCGAGGAATAAGTGGTTCAGCTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026448
VALIDATED
KLHL7 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026448.2-811s21c1
Sequence:CCGGCCAGCCATTCATGGTTGATATCTCGAGATATCAACCATGAATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026448.2-2537s21c1
Sequence:CCGGTAAGCTTAGCACCCATCATTACTCGAGTAATGATGGGTGCTAAGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026448.2-409s21c1
Sequence:CCGGAGATGCTGAACCTGATATTATCTCGAGATAATATCAGGTTCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026448.2-1772s21c1
Sequence:CCGGGGGCATATCCTTGAGTATAATCTCGAGATTATACTCAAGGATATGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026448.2-885s21c1
Sequence:CCGGTACAAGCTGAACCACTTATTCCTCGAGGAATAAGTGGTTCAGCTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026448
VALIDATED
KLHL7 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026448.2-811s21c1
Sequence:CCGGCCAGCCATTCATGGTTGATATCTCGAGATATCAACCATGAATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026448.2-2537s21c1
Sequence:CCGGTAAGCTTAGCACCCATCATTACTCGAGTAATGATGGGTGCTAAGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026448.2-409s21c1
Sequence:CCGGAGATGCTGAACCTGATATTATCTCGAGATAATATCAGGTTCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026448.2-1772s21c1
Sequence:CCGGGGGCATATCCTTGAGTATAATCTCGAGATTATACTCAAGGATATGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026448.2-885s21c1
Sequence:CCGGTACAAGCTGAACCACTTATTCCTCGAGGAATAAGTGGTTCAGCTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)