EMAIL THIS PAGE TO A FRIEND

KLHL8

kelch-like family member 8

86 Gene Product Result for
UniProtKB ID: Q9P2G9, Q53XA3
Gene ID:
Mouse(246293) kelch-like 8
Rat(289457) kelch-like family member 8
Zebrafish(572347) kelch-like 8 (Drosophila)
dog(487847) kelch-like 8 (Drosophila)
domestic cat(101096725) kelch-like 8 (Drosophila)
Horse(100062841) kelch-like 8 (Drosophila)
cow(532960) kelch-like family member 8
chicken(422589) kelch-like 8 (Drosophila)
sheep(101122109) kelch-like 8 (Drosophila)
domestic guinea pig(100713282) kelch-like family member 8
naked mole-rat(101720303) kelch-like family member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020803 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020803 Rosetta Predictions human pricing
NM_001105995 Rosetta Predictions rat pricing
NM_178741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123691 predicted 859
2 SASI_Hs01_00123692 predicted 1553
3 SASI_Hs01_00123693 predicted 456
4 SASI_Hs01_00123694 predicted 1118
5 SASI_Hs01_00123695 predicted 1336
6 SASI_Hs01_00123696 predicted 1541
7 SASI_Hs01_00123697 predicted 604
8 SASI_Hs01_00123698 predicted 1192
9 SASI_Hs01_00123699 predicted 1486
10 SASI_Hs01_00123700 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214592 predicted 2123
2 SASI_Rn02_00214593 predicted 1779
3 SASI_Rn02_00214594 predicted 1428
4 SASI_Rn02_00214595 predicted 1145
5 SASI_Rn02_00214596 predicted 2195
6 SASI_Rn02_00214597 predicted 1579
7 SASI_Rn02_00214598 predicted 1521
8 SASI_Rn02_00214599 predicted 1165
9 SASI_Rn02_00214600 predicted 1885
10 SASI_Rn02_00214601 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168662 predicted 706
2 SASI_Mm01_00168663 predicted 590
3 SASI_Mm01_00168665 predicted 1512
4 SASI_Mm01_00168666 predicted 1140
5 SASI_Mm01_00168667 predicted 1525
6 SASI_Mm01_00168668 predicted 1425
7 SASI_Mm01_00168669 predicted 1490
8 SASI_Mm02_00349278 predicted 671
9 SASI_Mm01_00168670 predicted 1573
10 SASI_Mm01_00168671 predicted 966
11 SASI_Mm01_00168664 predicted 812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020803
KLHL8 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-1935s1c1
Sequence:CCGGGTGGTCATAATGGCAATGCATCTCGAGATGCATTGCCATTATGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-1844s1c1
Sequence:CCGGCGAAGCAACAAGTGGGATTATCTCGAGATAATCCCACTTGTTGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-803s1c1
Sequence:CCGGGACTTAATGGACATGGCGGATCTCGAGATCCGCCATGTCCATTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-686s1c1
Sequence:CCGGGCCTGTATTCTGCAGGTTGAACTCGAGTTCAACCTGCAGAATACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-1453s1c1
Sequence:CCGGGAACACAAAGAGGCGAGGAATCTCGAGATTCCTCGCCTCTTTGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-1349s1c1
Sequence:CCGGGAAGGTAAAGTGTATGCAGTACTCGAGTACTGCATACACTTTACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-1256s1c1
Sequence:CCGGCGCAGTATTGAATGCTATTCTCTCGAGAGAATAGCATTCAATACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-1160s1c1
Sequence:CCGGCCTGACTTTGAATACTCCATTCTCGAGAATGGAGTATTCAAAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020803.3-2131s1c1
Sequence:CCGGGCCACCAACAATTTAGTCATACTCGAGTATGACTAAATTGTTGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-573s1c1
Sequence:CCGGCGCTGATTGAGATTAGAGATTCTCGAGAATCTCTAATCTCAATCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020803
KLHL8 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-1935s1c1
Sequence:CCGGGTGGTCATAATGGCAATGCATCTCGAGATGCATTGCCATTATGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-1844s1c1
Sequence:CCGGCGAAGCAACAAGTGGGATTATCTCGAGATAATCCCACTTGTTGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-803s1c1
Sequence:CCGGGACTTAATGGACATGGCGGATCTCGAGATCCGCCATGTCCATTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-686s1c1
Sequence:CCGGGCCTGTATTCTGCAGGTTGAACTCGAGTTCAACCTGCAGAATACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-1453s1c1
Sequence:CCGGGAACACAAAGAGGCGAGGAATCTCGAGATTCCTCGCCTCTTTGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-1349s1c1
Sequence:CCGGGAAGGTAAAGTGTATGCAGTACTCGAGTACTGCATACACTTTACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-1256s1c1
Sequence:CCGGCGCAGTATTGAATGCTATTCTCTCGAGAGAATAGCATTCAATACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-1160s1c1
Sequence:CCGGCCTGACTTTGAATACTCCATTCTCGAGAATGGAGTATTCAAAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020803.3-2131s1c1
Sequence:CCGGGCCACCAACAATTTAGTCATACTCGAGTATGACTAAATTGTTGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-573s1c1
Sequence:CCGGCGCTGATTGAGATTAGAGATTCTCGAGAATCTCTAATCTCAATCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020803
KLHL8 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-1935s1c1
Sequence:CCGGGTGGTCATAATGGCAATGCATCTCGAGATGCATTGCCATTATGACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-1844s1c1
Sequence:CCGGCGAAGCAACAAGTGGGATTATCTCGAGATAATCCCACTTGTTGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-803s1c1
Sequence:CCGGGACTTAATGGACATGGCGGATCTCGAGATCCGCCATGTCCATTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-686s1c1
Sequence:CCGGGCCTGTATTCTGCAGGTTGAACTCGAGTTCAACCTGCAGAATACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-1453s1c1
Sequence:CCGGGAACACAAAGAGGCGAGGAATCTCGAGATTCCTCGCCTCTTTGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-1349s1c1
Sequence:CCGGGAAGGTAAAGTGTATGCAGTACTCGAGTACTGCATACACTTTACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020803.3-1256s1c1
Sequence:CCGGCGCAGTATTGAATGCTATTCTCTCGAGAGAATAGCATTCAATACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-1160s1c1
Sequence:CCGGCCTGACTTTGAATACTCCATTCTCGAGAATGGAGTATTCAAAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020803.3-2131s1c1
Sequence:CCGGGCCACCAACAATTTAGTCATACTCGAGTATGACTAAATTGTTGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020803.3-573s1c1
Sequence:CCGGCGCTGATTGAGATTAGAGATTCTCGAGAATCTCTAATCTCAATCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178741
KLHL8 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178741.2-946s1c1
Sequence:CCGGCCTCAACATTGACAGTGAGAACTCGAGTTCTCACTGTCAATGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178741.2-2512s1c1
Sequence:CCGGCTCATCAACATGAGAACTTAACTCGAGTTAAGTTCTCATGTTGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-1789s21c1
Sequence:CCGGAGCGAGCTTCACGGTTGTTTACTCGAGTAAACAACCGTGAAGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178741.3-817s1c1
Sequence:CCGGCACAACCGAATAGACCTAATGCTCGAGCATTAGGTCTATTCGGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-701s21c1
Sequence:CCGGTGCTGTATGCAGCGTGTATTCCTCGAGGAATACACGCTGCATACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-1004s21c1
Sequence:CCGGATCCGCAACATCATCCTAAATCTCGAGATTTAGGATGATGTTGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178741.3-2658s21c1
Sequence:CCGGACATTCTTGAAACCATATTAGCTCGAGCTAATATGGTTTCAAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-585s21c1
Sequence:CCGGTGAAGCCAAGCAGGCGTTAATCTCGAGATTAACGCCTGCTTGGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178741
KLHL8 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178741.2-946s1c1
Sequence:CCGGCCTCAACATTGACAGTGAGAACTCGAGTTCTCACTGTCAATGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178741.2-2512s1c1
Sequence:CCGGCTCATCAACATGAGAACTTAACTCGAGTTAAGTTCTCATGTTGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-1789s21c1
Sequence:CCGGAGCGAGCTTCACGGTTGTTTACTCGAGTAAACAACCGTGAAGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178741.3-817s1c1
Sequence:CCGGCACAACCGAATAGACCTAATGCTCGAGCATTAGGTCTATTCGGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-701s21c1
Sequence:CCGGTGCTGTATGCAGCGTGTATTCCTCGAGGAATACACGCTGCATACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-1004s21c1
Sequence:CCGGATCCGCAACATCATCCTAAATCTCGAGATTTAGGATGATGTTGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178741.3-2658s21c1
Sequence:CCGGACATTCTTGAAACCATATTAGCTCGAGCTAATATGGTTTCAAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-585s21c1
Sequence:CCGGTGAAGCCAAGCAGGCGTTAATCTCGAGATTAACGCCTGCTTGGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178741
KLHL8 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178741.2-946s1c1
Sequence:CCGGCCTCAACATTGACAGTGAGAACTCGAGTTCTCACTGTCAATGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178741.2-2512s1c1
Sequence:CCGGCTCATCAACATGAGAACTTAACTCGAGTTAAGTTCTCATGTTGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-1789s21c1
Sequence:CCGGAGCGAGCTTCACGGTTGTTTACTCGAGTAAACAACCGTGAAGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178741.3-817s1c1
Sequence:CCGGCACAACCGAATAGACCTAATGCTCGAGCATTAGGTCTATTCGGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-701s21c1
Sequence:CCGGTGCTGTATGCAGCGTGTATTCCTCGAGGAATACACGCTGCATACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-1004s21c1
Sequence:CCGGATCCGCAACATCATCCTAAATCTCGAGATTTAGGATGATGTTGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178741.3-2658s21c1
Sequence:CCGGACATTCTTGAAACCATATTAGCTCGAGCTAATATGGTTTCAAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178741.3-585s21c1
Sequence:CCGGTGAAGCCAAGCAGGCGTTAATCTCGAGATTAACGCCTGCTTGGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)