EMAIL THIS PAGE TO A FRIEND

KLHL9

kelch-like family member 9

141 Gene Product Result for
UniProtKB ID: Q9P2J3, Q8TCQ2
Gene ID:
Mouse(242521) kelch-like 9
Rat(313348) kelch-like family member 9
domestic guinea pig(100729771) kelch-like family member 9
cow(767834) kelch-like 9 (Drosophila)
Horse(100064784) kelch-like 9 (Drosophila)
dog(481560) kelch-like 9 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018847 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018847 Rosetta Predictions human pricing
NM_001107944 Rosetta Predictions rat pricing
NM_172871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222443 predicted 1354
2 SASI_Hs01_00222444 predicted 2409
3 SASI_Hs01_00222445 predicted 2423
4 SASI_Hs01_00222446 predicted 2518
5 SASI_Hs01_00222448 predicted 1891
6 SASI_Hs02_00352307 predicted 1446
7 SASI_Hs01_00222450 predicted 603
8 SASI_Hs01_00222451 predicted 942
9 SASI_Hs01_00222452 predicted 1044
10 SASI_Hs02_00352308 predicted 1317
11 SASI_Hs01_00222447 predicted 1462
12 SASI_Hs01_00222449 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233825 predicted 1548
2 SASI_Rn02_00233826 predicted 1983
3 SASI_Rn02_00233827 predicted 1492
4 SASI_Rn02_00233828 predicted 1699
5 SASI_Rn02_00233829 predicted 2047
6 SASI_Rn02_00233830 predicted 1318
7 SASI_Rn02_00233831 predicted 2026
8 SASI_Rn02_00233832 predicted 1439
9 SASI_Rn02_00233833 predicted 1631
10 SASI_Rn02_00233834 predicted 2078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138429 predicted 1391
2 SASI_Mm01_00138430 predicted 2048
3 SASI_Mm01_00138431 predicted 1757
4 SASI_Mm01_00138432 predicted 602
5 SASI_Mm01_00138433 predicted 2142
6 SASI_Mm01_00138434 predicted 2109
7 SASI_Mm01_00138436 predicted 1535
8 SASI_Mm01_00138437 predicted 1972
9 SASI_Mm01_00138438 predicted 1437
10 SASI_Mm02_00344842 predicted 1446
11 SASI_Mm01_00138435 predicted 1623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018847
VALIDATED
KLHL9 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 9
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018847.2-2785s21c1
Sequence:CCGGACGAAAGGTTGCCAAGTATTACTCGAGTAATACTTGGCAACCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1357s21c1
Sequence:CCGGAGACAATACCTGCGTGAATTTCTCGAGAAATTCACGCAGGTATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1051s21c1
Sequence:CCGGTGCTAACACCTACAATCTTATCTCGAGATAAGATTGTAGGTGTTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1968s21c1
Sequence:CCGGTTGACCCAGATACAGATAAATCTCGAGATTTATCTGTATCTGGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018847.2-2449s21c1
Sequence:CCGGGTACGTCATGGGTGATCTAATCTCGAGATTAGATCACCCATGACGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1578s21c1
Sequence:CCGGCCCGTTACCAGCATGGTATTGCTCGAGCAATACCATGCTGGTAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-2212s21c1
Sequence:CCGGCTATGTTGTTGGTGGATATTCCTCGAGGAATATCCACCAACAACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018847.1-3081s1c1
Sequence:CCGGCCGTTTCTATTCAAATGGAAACTCGAGTTTCCATTTGAATAGAAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018847.1-1527s1c1
Sequence:CCGGCCAGCATGGTATTGCTGTCATCTCGAGATGACAGCAATACCATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018847.1-2203s1c1
Sequence:CCGGGTCCAGAAATATGACCCAGAACTCGAGTTCTGGGTCATATTTCTGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018847.1-1044s1c1
Sequence:CCGGCCTGAAGAACTTTCCTGCTTTCTCGAGAAAGCAGGAAAGTTCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018847.1-702s1c1
Sequence:CCGGCCCTGTTCACAGAGCTATGATCTCGAGATCATAGCTCTGTGAACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018847
VALIDATED
KLHL9 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 9
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018847.2-2785s21c1
Sequence:CCGGACGAAAGGTTGCCAAGTATTACTCGAGTAATACTTGGCAACCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1357s21c1
Sequence:CCGGAGACAATACCTGCGTGAATTTCTCGAGAAATTCACGCAGGTATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1051s21c1
Sequence:CCGGTGCTAACACCTACAATCTTATCTCGAGATAAGATTGTAGGTGTTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1968s21c1
Sequence:CCGGTTGACCCAGATACAGATAAATCTCGAGATTTATCTGTATCTGGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018847.2-2449s21c1
Sequence:CCGGGTACGTCATGGGTGATCTAATCTCGAGATTAGATCACCCATGACGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1578s21c1
Sequence:CCGGCCCGTTACCAGCATGGTATTGCTCGAGCAATACCATGCTGGTAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-2212s21c1
Sequence:CCGGCTATGTTGTTGGTGGATATTCCTCGAGGAATATCCACCAACAACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018847.1-3081s1c1
Sequence:CCGGCCGTTTCTATTCAAATGGAAACTCGAGTTTCCATTTGAATAGAAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018847.1-1527s1c1
Sequence:CCGGCCAGCATGGTATTGCTGTCATCTCGAGATGACAGCAATACCATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018847.1-2203s1c1
Sequence:CCGGGTCCAGAAATATGACCCAGAACTCGAGTTCTGGGTCATATTTCTGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018847.1-1044s1c1
Sequence:CCGGCCTGAAGAACTTTCCTGCTTTCTCGAGAAAGCAGGAAAGTTCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018847.1-702s1c1
Sequence:CCGGCCCTGTTCACAGAGCTATGATCTCGAGATCATAGCTCTGTGAACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018847
VALIDATED
KLHL9 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 9
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018847.2-2785s21c1
Sequence:CCGGACGAAAGGTTGCCAAGTATTACTCGAGTAATACTTGGCAACCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1357s21c1
Sequence:CCGGAGACAATACCTGCGTGAATTTCTCGAGAAATTCACGCAGGTATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1051s21c1
Sequence:CCGGTGCTAACACCTACAATCTTATCTCGAGATAAGATTGTAGGTGTTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1968s21c1
Sequence:CCGGTTGACCCAGATACAGATAAATCTCGAGATTTATCTGTATCTGGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018847.2-2449s21c1
Sequence:CCGGGTACGTCATGGGTGATCTAATCTCGAGATTAGATCACCCATGACGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-1578s21c1
Sequence:CCGGCCCGTTACCAGCATGGTATTGCTCGAGCAATACCATGCTGGTAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018847.2-2212s21c1
Sequence:CCGGCTATGTTGTTGGTGGATATTCCTCGAGGAATATCCACCAACAACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018847.1-3081s1c1
Sequence:CCGGCCGTTTCTATTCAAATGGAAACTCGAGTTTCCATTTGAATAGAAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018847.1-1527s1c1
Sequence:CCGGCCAGCATGGTATTGCTGTCATCTCGAGATGACAGCAATACCATGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018847.1-2203s1c1
Sequence:CCGGGTCCAGAAATATGACCCAGAACTCGAGTTCTGGGTCATATTTCTGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018847.1-1044s1c1
Sequence:CCGGCCTGAAGAACTTTCCTGCTTTCTCGAGAAAGCAGGAAAGTTCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018847.1-702s1c1
Sequence:CCGGCCCTGTTCACAGAGCTATGATCTCGAGATCATAGCTCTGTGAACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172871
VALIDATED
KLHL9 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172871.2-1616s1c1
Sequence:CCGGCAGATTTGATCCTCGTTATAACTCGAGTTATAACGAGGATCAAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-1616s21c1
Sequence:CCGGCAGATTTGATCCTCGTTATAACTCGAGTTATAACGAGGATCAAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-1008s21c1
Sequence:CCGGGAAGTGGATAAATACGTAAATCTCGAGATTTACGTATTTATCCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-2702s21c1
Sequence:CCGGCCCTGTTCTAACCTAATATAACTCGAGTTATATTAGGTTAGAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-1385s21c1
Sequence:CCGGTCGATCTGATTCTACTCATTTCTCGAGAAATGAGTAGAATCAGATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-596s21c1
Sequence:CCGGCACGCACAGTTCGGTTGTATTCTCGAGAATACAACCGAACTGTGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172871.1-1057s1c1
Sequence:CCGGCCTTTGTGCTTTCCAGCAATACTCGAGTATTGCTGGAAAGCACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172871.1-1391s1c1
Sequence:CCGGGCTAGTTGTCAGTAAAGAGTTCTCGAGAACTCTTTACTGACAACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172871.1-2658s1c1
Sequence:CCGGCCCTGTTCTAACCTAATATAACTCGAGTTATATTAGGTTAGAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172871
VALIDATED
KLHL9 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172871.2-1616s1c1
Sequence:CCGGCAGATTTGATCCTCGTTATAACTCGAGTTATAACGAGGATCAAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-1616s21c1
Sequence:CCGGCAGATTTGATCCTCGTTATAACTCGAGTTATAACGAGGATCAAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-1008s21c1
Sequence:CCGGGAAGTGGATAAATACGTAAATCTCGAGATTTACGTATTTATCCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-2702s21c1
Sequence:CCGGCCCTGTTCTAACCTAATATAACTCGAGTTATATTAGGTTAGAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-1385s21c1
Sequence:CCGGTCGATCTGATTCTACTCATTTCTCGAGAAATGAGTAGAATCAGATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-596s21c1
Sequence:CCGGCACGCACAGTTCGGTTGTATTCTCGAGAATACAACCGAACTGTGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172871.1-1057s1c1
Sequence:CCGGCCTTTGTGCTTTCCAGCAATACTCGAGTATTGCTGGAAAGCACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172871.1-1391s1c1
Sequence:CCGGGCTAGTTGTCAGTAAAGAGTTCTCGAGAACTCTTTACTGACAACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172871.1-2658s1c1
Sequence:CCGGCCCTGTTCTAACCTAATATAACTCGAGTTATATTAGGTTAGAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172871
VALIDATED
KLHL9 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172871.2-1616s1c1
Sequence:CCGGCAGATTTGATCCTCGTTATAACTCGAGTTATAACGAGGATCAAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-1616s21c1
Sequence:CCGGCAGATTTGATCCTCGTTATAACTCGAGTTATAACGAGGATCAAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-1008s21c1
Sequence:CCGGGAAGTGGATAAATACGTAAATCTCGAGATTTACGTATTTATCCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-2702s21c1
Sequence:CCGGCCCTGTTCTAACCTAATATAACTCGAGTTATATTAGGTTAGAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-1385s21c1
Sequence:CCGGTCGATCTGATTCTACTCATTTCTCGAGAAATGAGTAGAATCAGATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172871.2-596s21c1
Sequence:CCGGCACGCACAGTTCGGTTGTATTCTCGAGAATACAACCGAACTGTGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172871.1-1057s1c1
Sequence:CCGGCCTTTGTGCTTTCCAGCAATACTCGAGTATTGCTGGAAAGCACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172871.1-1391s1c1
Sequence:CCGGGCTAGTTGTCAGTAAAGAGTTCTCGAGAACTCTTTACTGACAACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172871.1-2658s1c1
Sequence:CCGGCCCTGTTCTAACCTAATATAACTCGAGTTATATTAGGTTAGAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)