EMAIL THIS PAGE TO A FRIEND

KLK10

kallikrein-related peptidase 10

129 Gene Product Result for
Synonyms: NES1 PRSSL1
UniProtKB ID: O43240, A6NC12, Q53YL3, Q99920, Q9GZW9
Gene ID:
Human(5655) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its encoded protein is secreted and may play a role in suppression of tumorigenesis in breast and prostate cancers. Alternate splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(69540) kallikrein related-peptidase 10
Rat(292850) kallikrein related-peptidase 10
domestic guinea pig(100716705) kallikrein-related peptidase 10
naked mole-rat(101714842) kallikrein-related peptidase 10
sheep(101112250) kallikrein-related peptidase 10
cow(526736) kallikrein-related peptidase 10
domestic cat(101088633) kallikrein-related peptidase 10
dog(484351) kallikrein-related peptidase 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0702 Human KLK10 / Kallikrein-10 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002776 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077500 Rosetta Predictions human pricing
NM_002776 Rosetta Predictions human pricing
NM_145888 Rosetta Predictions human pricing
NM_001004100 Rosetta Predictions rat pricing
XM_579125 Rosetta Predictions rat pricing
NM_133712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312854 predicted 459
2 SASI_Hs02_00312855 predicted 968
3 SASI_Hs02_00312856 predicted 897
4 SASI_Hs02_00312857 predicted 933
5 SASI_Hs02_00312858 predicted 936
6 SASI_Hs02_00312859 predicted 1011
7 SASI_Hs02_00312860 predicted 948
8 SASI_Hs02_00312861 predicted 879
9 SASI_Hs02_00312862 predicted 970
10 SASI_Hs02_00312863 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195423 predicted 554
2 SASI_Hs01_00195424 predicted 1073
3 SASI_Hs01_00195425 predicted 997
4 SASI_Hs01_00195426 predicted 1025
5 SASI_Hs01_00195427 predicted 1034
6 SASI_Hs01_00195428 predicted 1044
7 SASI_Hs01_00195429 predicted 980
8 SASI_Hs01_00195430 predicted 1077
9 SASI_Hs01_00195432 predicted 1002
10 SASI_Hs02_00334409 predicted 840
11 SASI_Hs01_00195431 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140047 predicted 413
2 SASI_Hs01_00140048 predicted 931
3 SASI_Hs01_00140049 predicted 850
4 SASI_Hs01_00140050 predicted 893
5 SASI_Hs01_00140051 predicted 897
6 SASI_Hs01_00140052 predicted 971
7 SASI_Hs01_00140053 predicted 905
8 SASI_Hs01_00140054 predicted 849
9 SASI_Hs01_00140055 predicted 937
10 SASI_Hs02_00365403 predicted 865
11 SASI_Hs01_00140056 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094189 predicted 203
2 SASI_Rn01_00094190 predicted 470
3 SASI_Rn01_00094191 predicted 320
4 SASI_Rn01_00094192 predicted 319
5 SASI_Rn01_00094193 predicted 437
6 SASI_Rn01_00094194 predicted 534
7 SASI_Rn01_00094195 predicted 243
8 SASI_Rn01_00094196 predicted 593
9 SASI_Rn01_00094197 predicted 608
10 SASI_Rn01_00094198 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129775 predicted 202
2 SASI_Rn01_00129776 predicted 467
3 SASI_Rn01_00129777 predicted 326
4 SASI_Rn01_00129778 predicted 323
5 SASI_Rn01_00129779 predicted 437
6 SASI_Rn01_00129780 predicted 537
7 SASI_Rn01_00129781 predicted 247
8 SASI_Rn01_00129782 predicted 601
9 SASI_Rn01_00129783 predicted 613
10 SASI_Rn01_00129784 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338682 predicted 376
2 SASI_Mm01_00048134 predicted 444
3 SASI_Mm01_00048135 predicted 376
4 SASI_Mm01_00048137 predicted 579
5 SASI_Mm01_00048138 predicted 512
6 SASI_Mm01_00048139 predicted 694
7 SASI_Mm01_00048140 predicted 792
8 SASI_Mm01_00048141 predicted 406
9 SASI_Mm02_00338683 predicted 316
10 SASI_Mm02_00338684 predicted 515
11 SASI_Mm01_00048133 predicted 452
12 SASI_Mm01_00048136 predicted 429
13 SASI_Mm01_00048142 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002776
KLK10 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002776.4-1471s21c1
Sequence:CCGGTGTGAGGAGACTATGATATAACTCGAGTTATATCATAGTCTCCTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002776.4-1065s21c1
Sequence:CCGGTCCAGCTGATCCAGATGTTATCTCGAGATAACATCTGGATCAGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002776.4-842s21c1
Sequence:CCGGTGGTCACCAACAACATGATATCTCGAGATATCATGTTGTTGGTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-756s1c1
Sequence:CCGGCCGGAGAGTGAAGTACAACAACTCGAGTTGTTGTACTTCACTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-996s1c1
Sequence:CCGGCACCCAGATCTGCAAATACATCTCGAGATGTATTTGCAGATCTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-393s1c1
Sequence:CCGGCTGGCAGGTCTCGCTCTTCAACTCGAGTTGAAGAGCGAGACCTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-794s1c1
Sequence:CCGGGCATCACTATCCTGAGCCCTACTCGAGTAGGGCTCAGGATAGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-1017s1c1
Sequence:CCGGGTCCTGGATCAATAAAGTCATCTCGAGATGACTTTATTGATCCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002776
KLK10 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002776.4-1471s21c1
Sequence:CCGGTGTGAGGAGACTATGATATAACTCGAGTTATATCATAGTCTCCTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002776.4-1065s21c1
Sequence:CCGGTCCAGCTGATCCAGATGTTATCTCGAGATAACATCTGGATCAGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002776.4-842s21c1
Sequence:CCGGTGGTCACCAACAACATGATATCTCGAGATATCATGTTGTTGGTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-756s1c1
Sequence:CCGGCCGGAGAGTGAAGTACAACAACTCGAGTTGTTGTACTTCACTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-996s1c1
Sequence:CCGGCACCCAGATCTGCAAATACATCTCGAGATGTATTTGCAGATCTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-393s1c1
Sequence:CCGGCTGGCAGGTCTCGCTCTTCAACTCGAGTTGAAGAGCGAGACCTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-794s1c1
Sequence:CCGGGCATCACTATCCTGAGCCCTACTCGAGTAGGGCTCAGGATAGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-1017s1c1
Sequence:CCGGGTCCTGGATCAATAAAGTCATCTCGAGATGACTTTATTGATCCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002776
KLK10 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002776.4-1471s21c1
Sequence:CCGGTGTGAGGAGACTATGATATAACTCGAGTTATATCATAGTCTCCTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002776.4-1065s21c1
Sequence:CCGGTCCAGCTGATCCAGATGTTATCTCGAGATAACATCTGGATCAGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002776.4-842s21c1
Sequence:CCGGTGGTCACCAACAACATGATATCTCGAGATATCATGTTGTTGGTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-756s1c1
Sequence:CCGGCCGGAGAGTGAAGTACAACAACTCGAGTTGTTGTACTTCACTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-996s1c1
Sequence:CCGGCACCCAGATCTGCAAATACATCTCGAGATGTATTTGCAGATCTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-393s1c1
Sequence:CCGGCTGGCAGGTCTCGCTCTTCAACTCGAGTTGAAGAGCGAGACCTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-794s1c1
Sequence:CCGGGCATCACTATCCTGAGCCCTACTCGAGTAGGGCTCAGGATAGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002776.3-1017s1c1
Sequence:CCGGGTCCTGGATCAATAAAGTCATCTCGAGATGACTTTATTGATCCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133712
KLK10 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-942s1c1
Sequence:CCGGCGAAGAGTCATTCGTTTCAAACTCGAGTTTGAAACGAATGACTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-317s1c1
Sequence:CCGGCCTCTTCCATAACCTCCAGTTCTCGAGAACTGGAGGTTATGGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-787s1c1
Sequence:CCGGCAGACGGAAACCAAGACTCTTCTCGAGAAGAGTCTTGGTTTCCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-383s1c1
Sequence:CCGGCGCACATTGCTGGAGAAATAACTCGAGTTATTTCTCCAGCAATGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-670s1c1
Sequence:CCGGGCCGAAGAGTGAAGTACAATACTCGAGTATTGTACTTCACTCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133712
KLK10 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-942s1c1
Sequence:CCGGCGAAGAGTCATTCGTTTCAAACTCGAGTTTGAAACGAATGACTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-317s1c1
Sequence:CCGGCCTCTTCCATAACCTCCAGTTCTCGAGAACTGGAGGTTATGGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-787s1c1
Sequence:CCGGCAGACGGAAACCAAGACTCTTCTCGAGAAGAGTCTTGGTTTCCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-383s1c1
Sequence:CCGGCGCACATTGCTGGAGAAATAACTCGAGTTATTTCTCCAGCAATGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-670s1c1
Sequence:CCGGGCCGAAGAGTGAAGTACAATACTCGAGTATTGTACTTCACTCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133712
KLK10 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-942s1c1
Sequence:CCGGCGAAGAGTCATTCGTTTCAAACTCGAGTTTGAAACGAATGACTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-317s1c1
Sequence:CCGGCCTCTTCCATAACCTCCAGTTCTCGAGAACTGGAGGTTATGGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-787s1c1
Sequence:CCGGCAGACGGAAACCAAGACTCTTCTCGAGAAGAGTCTTGGTTTCCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-383s1c1
Sequence:CCGGCGCACATTGCTGGAGAAATAACTCGAGTTATTTCTCCAGCAATGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133712.1-670s1c1
Sequence:CCGGGCCGAAGAGTGAAGTACAATACTCGAGTATTGTACTTCACTCTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)