EMAIL THIS PAGE TO A FRIEND

KLK11

kallikrein-related peptidase 11

62 Gene Product Result for
Synonyms: PRSS20 TLSP
UniProtKB ID: Q9UBX7, O75837, Q0WXX5, Q8IXD7, Q9NS65
Gene ID:
Human(11012) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in multiple transcript variants encoding distinct isoforms which are differentially expressed.[provided by RefSeq, Nov 2009]
Mouse(56538) kallikrein related-peptidase 11
Rat(292849) kallikrein related-peptidase 11
cow(526737) kallikrein-related peptidase 11
dog(476401) kallikrein-related peptidase 11
sheep(101113783) kallikrein-related peptidase 11
domestic guinea pig(100716432) kallikrein-related peptidase 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006853 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006853 Rosetta Predictions human pricing
NM_144947 Rosetta Predictions human pricing
NM_001106252 Rosetta Predictions rat pricing
NM_019974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094831 predicted 801
2 SASI_Hs01_00094832 predicted 794
3 SASI_Hs01_00094834 predicted 753
4 SASI_Hs01_00094835 predicted 433
5 SASI_Hs01_00094836 predicted 516
6 SASI_Hs01_00094837 predicted 594
7 SASI_Hs01_00094838 predicted 628
8 SASI_Hs01_00094839 predicted 796
9 SASI_Hs01_00094840 predicted 781
10 SASI_Hs02_00342460 predicted 778
11 SASI_Hs01_00094833 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082084 predicted 880
2 SASI_Hs01_00082085 predicted 876
3 SASI_Hs01_00082087 predicted 835
4 SASI_Hs01_00082088 predicted 515
5 SASI_Hs01_00082089 predicted 594
6 SASI_Hs01_00082090 predicted 677
7 SASI_Hs01_00082091 predicted 703
8 SASI_Hs01_00082092 predicted 884
9 SASI_Hs01_00082093 predicted 864
10 SASI_Hs02_00364736 predicted 865
11 SASI_Hs01_00082086 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217138 predicted 533
2 SASI_Rn02_00217139 predicted 765
3 SASI_Rn02_00217140 predicted 608
4 SASI_Rn02_00217141 predicted 260
5 SASI_Rn02_00217142 predicted 211
6 SASI_Rn02_00217143 predicted 761
7 SASI_Rn02_00217144 predicted 228
8 SASI_Rn02_00217145 predicted 275
9 SASI_Rn02_00217146 predicted 281
10 SASI_Rn02_00217147 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196137 predicted 385
2 SASI_Mm01_00196138 predicted 280
3 SASI_Mm01_00196139 predicted 743
4 SASI_Mm01_00196141 predicted 378
5 SASI_Mm01_00196142 predicted 620
6 SASI_Mm02_00325278 predicted 729
7 SASI_Mm01_00196144 predicted 553
8 SASI_Mm01_00196145 predicted 796
9 SASI_Mm01_00196146 predicted 775
10 SASI_Mm02_00325279 predicted 604
11 SASI_Mm01_00196140 predicted 619
12 SASI_Mm01_00196143 predicted 774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019974
KLK11 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019974.1-988s1c1
Sequence:CCGGCCTGGAATCAAATCCTGACTTCTCGAGAAGTCAGGATTTGATTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-700s1c1
Sequence:CCGGCGGATCTCTTCAAGGCATCATCTCGAGATGATGCCTTGAAGAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-127s1c1
Sequence:CCGGGACGAGGATCATCAAGGGTTACTCGAGTAACCCTTGATGATCCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-377s1c1
Sequence:CCGGCCCAACAAAGACCACCGGAATCTCGAGATTCCGGTGGTCTTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-799s1c1
Sequence:CCGGCCACGAGGTTATGAGGAACAACTCGAGTTGTTCCTCATAACCTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019974
KLK11 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019974.1-988s1c1
Sequence:CCGGCCTGGAATCAAATCCTGACTTCTCGAGAAGTCAGGATTTGATTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-700s1c1
Sequence:CCGGCGGATCTCTTCAAGGCATCATCTCGAGATGATGCCTTGAAGAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-127s1c1
Sequence:CCGGGACGAGGATCATCAAGGGTTACTCGAGTAACCCTTGATGATCCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-377s1c1
Sequence:CCGGCCCAACAAAGACCACCGGAATCTCGAGATTCCGGTGGTCTTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-799s1c1
Sequence:CCGGCCACGAGGTTATGAGGAACAACTCGAGTTGTTCCTCATAACCTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019974
KLK11 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019974.1-988s1c1
Sequence:CCGGCCTGGAATCAAATCCTGACTTCTCGAGAAGTCAGGATTTGATTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-700s1c1
Sequence:CCGGCGGATCTCTTCAAGGCATCATCTCGAGATGATGCCTTGAAGAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-127s1c1
Sequence:CCGGGACGAGGATCATCAAGGGTTACTCGAGTAACCCTTGATGATCCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-377s1c1
Sequence:CCGGCCCAACAAAGACCACCGGAATCTCGAGATTCCGGTGGTCTTTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019974.1-799s1c1
Sequence:CCGGCCACGAGGTTATGAGGAACAACTCGAGTTGTTCCTCATAACCTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006853
KLK11 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-745s1c1
Sequence:CCGGCTGGTCTGTAACCAGTCTCTTCTCGAGAAGAGACTGGTTACAGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-154s1c1
Sequence:CCGGGCTCTGGCAACAGGGCTTGTACTCGAGTACAAGCCCTGTTGCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-633s1c1
Sequence:CCGGTGAGCACCAGAAGTGTGAGAACTCGAGTTCTCACACTTCTGGTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-820s1c1
Sequence:CCGGGTCTACACGAAAGTCTGCAAACTCGAGTTTGCAGACTTTCGTGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-855s1c1
Sequence:CCGGCCAGGAGACGATGAAGAACAACTCGAGTTGTTCTTCATCGTCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006853.2-434s21c1
Sequence:CCGGCCAACAAAGACCACCGCAATGCTCGAGCATTGCGGTGGTCTTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006853.2-1008s21c1
Sequence:CCGGGAGATGCTGTCACTTAATAATCTCGAGATTATTAAGTGACAGCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006853.2-966s21c1
Sequence:CCGGCAAGACCCTCTACGAACATTCCTCGAGGAATGTTCGTAGAGGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006853
KLK11 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-745s1c1
Sequence:CCGGCTGGTCTGTAACCAGTCTCTTCTCGAGAAGAGACTGGTTACAGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-154s1c1
Sequence:CCGGGCTCTGGCAACAGGGCTTGTACTCGAGTACAAGCCCTGTTGCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-633s1c1
Sequence:CCGGTGAGCACCAGAAGTGTGAGAACTCGAGTTCTCACACTTCTGGTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-820s1c1
Sequence:CCGGGTCTACACGAAAGTCTGCAAACTCGAGTTTGCAGACTTTCGTGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-855s1c1
Sequence:CCGGCCAGGAGACGATGAAGAACAACTCGAGTTGTTCTTCATCGTCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006853.2-434s21c1
Sequence:CCGGCCAACAAAGACCACCGCAATGCTCGAGCATTGCGGTGGTCTTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006853.2-1008s21c1
Sequence:CCGGGAGATGCTGTCACTTAATAATCTCGAGATTATTAAGTGACAGCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006853.2-966s21c1
Sequence:CCGGCAAGACCCTCTACGAACATTCCTCGAGGAATGTTCGTAGAGGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006853
KLK11 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-745s1c1
Sequence:CCGGCTGGTCTGTAACCAGTCTCTTCTCGAGAAGAGACTGGTTACAGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-154s1c1
Sequence:CCGGGCTCTGGCAACAGGGCTTGTACTCGAGTACAAGCCCTGTTGCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-633s1c1
Sequence:CCGGTGAGCACCAGAAGTGTGAGAACTCGAGTTCTCACACTTCTGGTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-820s1c1
Sequence:CCGGGTCTACACGAAAGTCTGCAAACTCGAGTTTGCAGACTTTCGTGTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006853.2-855s1c1
Sequence:CCGGCCAGGAGACGATGAAGAACAACTCGAGTTGTTCTTCATCGTCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006853.2-434s21c1
Sequence:CCGGCCAACAAAGACCACCGCAATGCTCGAGCATTGCGGTGGTCTTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006853.2-1008s21c1
Sequence:CCGGGAGATGCTGTCACTTAATAATCTCGAGATTATTAAGTGACAGCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006853.2-966s21c1
Sequence:CCGGCAAGACCCTCTACGAACATTCCTCGAGGAATGTTCGTAGAGGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)