EMAIL THIS PAGE TO A FRIEND

KLK12

kallikrein-related peptidase 12

99 Gene Product Result for
Synonyms: KLK-L5 KLKL5
UniProtKB ID: Q9UKR0, Q9UKR1, Q9UKR2
Gene ID:
Human(43849) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(69511) kallikrein related-peptidase 12
Rat(308564) kallikrein related-peptidase 12
domestic guinea pig(100716145) kallikrein-related peptidase 12
naked mole-rat(101705144) kallikrein-related peptidase 12
sheep(101113003) kallikrein-related peptidase 12
cow(618448) kallikrein-related peptidase 12
dog(611766) kallikrein-related peptidase 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_133409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019598 Rosetta Predictions human pricing
NM_145894 Rosetta Predictions human pricing
NM_145895 Rosetta Predictions human pricing
NM_001107508 Rosetta Predictions rat pricing
XM_893506 Rosetta Predictions mouse pricing
XM_914283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039061 predicted 378
2 SASI_Hs01_00039063 predicted 497
3 SASI_Hs01_00039064 predicted 469
4 SASI_Hs01_00039065 predicted 455
5 SASI_Hs01_00039066 predicted 523
6 SASI_Hs01_00039067 predicted 570
7 SASI_Hs01_00039068 predicted 341
8 SASI_Hs01_00039069 predicted 469
9 SASI_Hs01_00039070 predicted 342
10 SASI_Hs02_00352800 predicted 404
11 SASI_Hs01_00039062 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170223 predicted 371
2 SASI_Hs01_00170225 predicted 497
3 SASI_Hs01_00170226 predicted 462
4 SASI_Hs01_00170227 predicted 452
5 SASI_Hs01_00170228 predicted 519
6 SASI_Hs01_00170229 predicted 573
7 SASI_Hs01_00170230 predicted 340
8 SASI_Hs01_00170231 predicted 471
9 SASI_Hs01_00170232 predicted 344
10 SASI_Hs02_00365407 predicted 403
11 SASI_Hs01_00170224 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123349 predicted 569
2 SASI_Hs02_00365408 predicted 528
3 SASI_Hs01_00123350 predicted 549
4 SASI_Hs02_00365409 predicted 530
5 SASI_Hs01_00123351 predicted 543
6 SASI_Hs01_00123352 predicted 534
7 SASI_Hs01_00123353 predicted 533
8 SASI_Hs01_00123354 predicted 529
9 SASI_Hs01_00123355 predicted 542
10 SASI_Hs01_00123356 predicted 532
11 SASI_Hs01_00123357 predicted 589
12 SASI_Hs01_00123358 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229515 predicted 487
2 SASI_Rn02_00229516 predicted 669
3 SASI_Rn02_00229517 predicted 245
4 SASI_Rn02_00229518 predicted 266
5 SASI_Rn02_00229519 predicted 474
6 SASI_Rn02_00229520 predicted 506
7 SASI_Rn02_00229521 predicted 238
8 SASI_Rn02_00229522 predicted 649
9 SASI_Rn02_00229523 predicted 300
10 SASI_Rn02_00229524 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270634 predicted 706
2 SASI_Mm01_00270635 predicted 681
3 SASI_Mm01_00270636 predicted 530
4 SASI_Mm01_00270637 predicted 701
5 SASI_Mm01_00270638 predicted 703
6 SASI_Mm02_00429330 predicted 692
7 SASI_Mm01_00270639 predicted 673
8 SASI_Mm01_00270640 predicted 686
9 SASI_Mm01_00270641 predicted 683
10 SASI_Mm01_00270642 predicted 698
11 SASI_Mm01_00270643 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438426 predicted 703
2 SASI_Mm02_00438427 predicted 216
3 SASI_Mm02_00438428 predicted 380
4 SASI_Mm02_00438429 predicted 532
5 SASI_Mm02_00438430 predicted 299
6 SASI_Mm02_00438431 predicted 280
7 SASI_Mm02_00438432 predicted 386
8 SASI_Mm02_00438433 predicted 282
9 SASI_Mm02_00438434 predicted 694
10 SASI_Mm02_00438435 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019598
KLK12 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-472s21c1
Sequence:CCGGCGCGTAACCAGCAGCGTTCAACTCGAGTTGAACGCTGCTGGTTACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-570s21c1
Sequence:CCGGACGGAACCCATTCCCGGATCTCTCGAGAGATCCGGGAATGGGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-740s21c1
Sequence:CCGGGAGTCCTTCAAGGTCTGGTGTCTCGAGACACCAGACCTTGAAGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-261s21c1
Sequence:CCGGGGGTGTCCTTATTGACCACAGCTCGAGCTGTGGTCAATAAGGACACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-594s1c1
Sequence:CCGGCCAGTGCCTCAACCTCTCCATCTCGAGATGGAGAGGTTGAGGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-354s1c1
Sequence:CCGGGCTCGACTGGACCGAGCAGATCTCGAGATCTGCTCGGTCCAGTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-164s1c1
Sequence:CCGGAGGCAGCCACACCGAAGATTTCTCGAGAAATCTTCGGTGTGGCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-794s1c1
Sequence:CCGGGCATCCCTGGAGTCTACACCTCTCGAGAGGTGTAGACTCCAGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019598
KLK12 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-472s21c1
Sequence:CCGGCGCGTAACCAGCAGCGTTCAACTCGAGTTGAACGCTGCTGGTTACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-570s21c1
Sequence:CCGGACGGAACCCATTCCCGGATCTCTCGAGAGATCCGGGAATGGGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-740s21c1
Sequence:CCGGGAGTCCTTCAAGGTCTGGTGTCTCGAGACACCAGACCTTGAAGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-261s21c1
Sequence:CCGGGGGTGTCCTTATTGACCACAGCTCGAGCTGTGGTCAATAAGGACACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-594s1c1
Sequence:CCGGCCAGTGCCTCAACCTCTCCATCTCGAGATGGAGAGGTTGAGGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-354s1c1
Sequence:CCGGGCTCGACTGGACCGAGCAGATCTCGAGATCTGCTCGGTCCAGTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-164s1c1
Sequence:CCGGAGGCAGCCACACCGAAGATTTCTCGAGAAATCTTCGGTGTGGCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-794s1c1
Sequence:CCGGGCATCCCTGGAGTCTACACCTCTCGAGAGGTGTAGACTCCAGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019598
KLK12 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-472s21c1
Sequence:CCGGCGCGTAACCAGCAGCGTTCAACTCGAGTTGAACGCTGCTGGTTACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-570s21c1
Sequence:CCGGACGGAACCCATTCCCGGATCTCTCGAGAGATCCGGGAATGGGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-740s21c1
Sequence:CCGGGAGTCCTTCAAGGTCTGGTGTCTCGAGACACCAGACCTTGAAGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019598.2-261s21c1
Sequence:CCGGGGGTGTCCTTATTGACCACAGCTCGAGCTGTGGTCAATAAGGACACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-594s1c1
Sequence:CCGGCCAGTGCCTCAACCTCTCCATCTCGAGATGGAGAGGTTGAGGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-354s1c1
Sequence:CCGGGCTCGACTGGACCGAGCAGATCTCGAGATCTGCTCGGTCCAGTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-164s1c1
Sequence:CCGGAGGCAGCCACACCGAAGATTTCTCGAGAAATCTTCGGTGTGGCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019598.2-794s1c1
Sequence:CCGGGCATCCCTGGAGTCTACACCTCTCGAGAGGTGTAGACTCCAGGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133409
KLK12 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-410s1c1
Sequence:CCGGCCATGTGTCATGTCTCAGGATCTCGAGATCCTGAGACATGACACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-304s1c1
Sequence:CCGGCAGAACCATGAGCATGATCTTCTCGAGAAGATCATGCTCATGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-52s1c1
Sequence:CCGGGACAGGGAGAAGATCTATAATCTCGAGATTATAGATCTTCTCCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-720s1c1
Sequence:CCGGCAGAATAGTCATCAGGAATAACTCGAGTTATTCCTGATGACTATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-699s1c1
Sequence:CCGGCTGCAAATACACGGACTGGATCTCGAGATCCAGTCCGTGTATTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133409
KLK12 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-410s1c1
Sequence:CCGGCCATGTGTCATGTCTCAGGATCTCGAGATCCTGAGACATGACACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-304s1c1
Sequence:CCGGCAGAACCATGAGCATGATCTTCTCGAGAAGATCATGCTCATGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-52s1c1
Sequence:CCGGGACAGGGAGAAGATCTATAATCTCGAGATTATAGATCTTCTCCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-720s1c1
Sequence:CCGGCAGAATAGTCATCAGGAATAACTCGAGTTATTCCTGATGACTATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-699s1c1
Sequence:CCGGCTGCAAATACACGGACTGGATCTCGAGATCCAGTCCGTGTATTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133409
KLK12 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-410s1c1
Sequence:CCGGCCATGTGTCATGTCTCAGGATCTCGAGATCCTGAGACATGACACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-304s1c1
Sequence:CCGGCAGAACCATGAGCATGATCTTCTCGAGAAGATCATGCTCATGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-52s1c1
Sequence:CCGGGACAGGGAGAAGATCTATAATCTCGAGATTATAGATCTTCTCCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-720s1c1
Sequence:CCGGCAGAATAGTCATCAGGAATAACTCGAGTTATTCCTGATGACTATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133409.2-699s1c1
Sequence:CCGGCTGCAAATACACGGACTGGATCTCGAGATCCAGTCCGTGTATTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)