EMAIL THIS PAGE TO A FRIEND

KLK14

kallikrein-related peptidase 14

53 Gene Product Result for
Synonyms: KLK-L6
UniProtKB ID: Q9P0G3, A7UNK5, Q1RMZ2, Q6B089
Gene ID:
Human(43847) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. An additional transcript variant has been described but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(317653) kallikrein related-peptidase 14
Rat(308562) kallikrein related-peptidase 14
domestic guinea pig(100715670) kallikrein-related peptidase 14
naked mole-rat(101704435) kallikrein-related peptidase 14
sheep(101120354) kallikrein-related peptidase 14
dog(484348) kallikrein-related peptidase 14
cow(613993) kallikrein-related peptidase 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0703 Human KLK14 / Kallikrein-14 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026801 MISSION® esiRNA esiRNA targeting mouse Klk14 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022046 Rosetta Predictions human pricing
XM_001080394 Rosetta Predictions rat pricing
XM_218641 Rosetta Predictions rat pricing
NM_174866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010891 predicted 286
2 SASI_Hs02_00355397 predicted 309
3 SASI_Hs02_00355398 predicted 771
4 SASI_Hs01_00010892 predicted 785
5 SASI_Hs01_00010893 predicted 636
6 SASI_Hs01_00010894 predicted 276
7 SASI_Hs01_00010895 predicted 345
8 SASI_Hs01_00010897 predicted 785
9 SASI_Hs01_00010898 predicted 344
10 SASI_Hs01_00010899 predicted 784
11 SASI_Hs01_00010896 predicted 331
12 SASI_Hs01_00010900 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367845 predicted 979
2 SASI_Rn02_00367846 predicted 765
3 SASI_Rn02_00367847 predicted 1058
4 SASI_Rn02_00367848 predicted 638
5 SASI_Rn02_00367849 predicted 313
6 SASI_Rn02_00367850 predicted 400
7 SASI_Rn02_00367851 predicted 232
8 SASI_Rn02_00367852 predicted 612
9 SASI_Rn02_00367853 predicted 941
10 SASI_Rn02_00367854 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377913 predicted 976
2 SASI_Rn02_00377914 predicted 763
3 SASI_Rn02_00377915 predicted 1061
4 SASI_Rn02_00377916 predicted 638
5 SASI_Rn02_00377917 predicted 320
6 SASI_Rn02_00377918 predicted 400
7 SASI_Rn02_00377919 predicted 234
8 SASI_Rn02_00377920 predicted 616
9 SASI_Rn02_00377921 predicted 940
10 SASI_Rn02_00377922 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094142 predicted 217
2 SASI_Mm01_00094143 predicted 410
3 SASI_Mm01_00094144 predicted 202
4 SASI_Mm01_00094145 predicted 359
5 SASI_Mm01_00094146 predicted 525
6 SASI_Mm01_00094147 predicted 501
7 SASI_Mm01_00094148 predicted 444
8 SASI_Mm01_00094149 predicted 315
9 SASI_Mm01_00094150 predicted 317
10 SASI_Mm01_00094151 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022046
KLK14 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022046.4-437s21c1
Sequence:CCGGTTTCAGGCCAGTGGGTCATCACTCGAGTGATGACCCACTGGCCTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022046.4-271s21c1
Sequence:CCGGTTCCTCCTGCTGACAGCACTTCTCGAGAAGTGCTGTCAGCAGGAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022046.4-791s21c1
Sequence:CCGGGCCAGAAGGCCTATCCTAGAACTCGAGTTCTAGGATAGGCCTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-753s1c1
Sequence:CCGGGCAATGCGTGAACATCAACATCTCGAGATGTTGATGTTCACGCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-320s1c1
Sequence:CCGGGCCAAGAGGATGAGAACAAGACTCGAGTCTTGTTCTCATCCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-747s1c1
Sequence:CCGGCTCTCTGCAATGCGTGAACATCTCGAGATGTTCACGCATTGCAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-1001s1c1
Sequence:CCGGAGGAAACGATGCGGGACAAATCTCGAGATTTGTCCCGCATCGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-297s1c1
Sequence:CCGGCCTGGCTATAGCCATGACACACTCGAGTGTGTCATGGCTATAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022046
KLK14 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022046.4-437s21c1
Sequence:CCGGTTTCAGGCCAGTGGGTCATCACTCGAGTGATGACCCACTGGCCTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022046.4-271s21c1
Sequence:CCGGTTCCTCCTGCTGACAGCACTTCTCGAGAAGTGCTGTCAGCAGGAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022046.4-791s21c1
Sequence:CCGGGCCAGAAGGCCTATCCTAGAACTCGAGTTCTAGGATAGGCCTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-753s1c1
Sequence:CCGGGCAATGCGTGAACATCAACATCTCGAGATGTTGATGTTCACGCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-320s1c1
Sequence:CCGGGCCAAGAGGATGAGAACAAGACTCGAGTCTTGTTCTCATCCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-747s1c1
Sequence:CCGGCTCTCTGCAATGCGTGAACATCTCGAGATGTTCACGCATTGCAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-1001s1c1
Sequence:CCGGAGGAAACGATGCGGGACAAATCTCGAGATTTGTCCCGCATCGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-297s1c1
Sequence:CCGGCCTGGCTATAGCCATGACACACTCGAGTGTGTCATGGCTATAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022046
KLK14 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022046.4-437s21c1
Sequence:CCGGTTTCAGGCCAGTGGGTCATCACTCGAGTGATGACCCACTGGCCTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022046.4-271s21c1
Sequence:CCGGTTCCTCCTGCTGACAGCACTTCTCGAGAAGTGCTGTCAGCAGGAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022046.4-791s21c1
Sequence:CCGGGCCAGAAGGCCTATCCTAGAACTCGAGTTCTAGGATAGGCCTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-753s1c1
Sequence:CCGGGCAATGCGTGAACATCAACATCTCGAGATGTTGATGTTCACGCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-320s1c1
Sequence:CCGGGCCAAGAGGATGAGAACAAGACTCGAGTCTTGTTCTCATCCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-747s1c1
Sequence:CCGGCTCTCTGCAATGCGTGAACATCTCGAGATGTTCACGCATTGCAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-1001s1c1
Sequence:CCGGAGGAAACGATGCGGGACAAATCTCGAGATTTGTCCCGCATCGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022046.3-297s1c1
Sequence:CCGGCCTGGCTATAGCCATGACACACTCGAGTGTGTCATGGCTATAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174866
KLK14 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-483s1c1
Sequence:CCGGGCAGTGTGTGAATGTCAACATCTCGAGATGTTGACATTCACACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-234s1c1
Sequence:CCGGGCACAACATAAGAAGGTGGGACTCGAGTCCCACCTTCTTATGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-158s1c1
Sequence:CCGGGAGTCCTGTTGTCAGATCAATCTCGAGATTGATCTGACAACAGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-318s1c1
Sequence:CCGGCCACGATAATGACCTCATGCTCTCGAGAGCATGAGGTCATTATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-530s1c1
Sequence:CCGGCCTACCCTGGAATCATAACATCTCGAGATGTTATGATTCCAGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174866
KLK14 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-483s1c1
Sequence:CCGGGCAGTGTGTGAATGTCAACATCTCGAGATGTTGACATTCACACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-234s1c1
Sequence:CCGGGCACAACATAAGAAGGTGGGACTCGAGTCCCACCTTCTTATGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-158s1c1
Sequence:CCGGGAGTCCTGTTGTCAGATCAATCTCGAGATTGATCTGACAACAGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-318s1c1
Sequence:CCGGCCACGATAATGACCTCATGCTCTCGAGAGCATGAGGTCATTATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-530s1c1
Sequence:CCGGCCTACCCTGGAATCATAACATCTCGAGATGTTATGATTCCAGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174866
KLK14 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-483s1c1
Sequence:CCGGGCAGTGTGTGAATGTCAACATCTCGAGATGTTGACATTCACACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-234s1c1
Sequence:CCGGGCACAACATAAGAAGGTGGGACTCGAGTCCCACCTTCTTATGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-158s1c1
Sequence:CCGGGAGTCCTGTTGTCAGATCAATCTCGAGATTGATCTGACAACAGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-318s1c1
Sequence:CCGGCCACGATAATGACCTCATGCTCTCGAGAGCATGAGGTCATTATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174866.1-530s1c1
Sequence:CCGGCCTACCCTGGAATCATAACATCTCGAGATGTTATGATTCCAGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)