EMAIL THIS PAGE TO A FRIEND

KLK15

kallikrein-related peptidase 15

101 Gene Product Result for
Synonyms: ACO HSRNASPH
Gene ID:
Human(55554) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(317652) kallikrein related-peptidase 15
Rat(292873) kallikrein-related peptidase 15
dog(480822) kallikrein-related peptidase 15
domestic cat(101098181) kallikrein-related peptidase 15
cow(100140565) kallikrein-related peptidase 15
sheep(101114045) kallikrein-related peptidase 15
domestic guinea pig(100717252) kallikrein-related peptidase 15
naked mole-rat(101718429) kallikrein-related peptidase 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017509 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092141 MISSION® esiRNA esiRNA human KLK15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017509 Rosetta Predictions human pricing
NM_023006 Rosetta Predictions human pricing
NM_138563 Rosetta Predictions human pricing
NM_138564 Rosetta Predictions human pricing
XM_001080538 Rosetta Predictions rat pricing
NM_174865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027676 predicted 913
2 SASI_Hs01_00027677 predicted 906
3 SASI_Hs01_00027678 predicted 863
4 SASI_Hs01_00027679 predicted 909
5 SASI_Hs01_00027680 predicted 864
6 SASI_Hs01_00027681 predicted 908
7 SASI_Hs01_00027682 predicted 912
8 SASI_Hs01_00027683 predicted 922
9 SASI_Hs01_00027684 predicted 894
10 SASI_Hs01_00027685 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191904 predicted 803
2 SASI_Hs01_00191905 predicted 793
3 SASI_Hs01_00191906 predicted 743
4 SASI_Hs01_00191907 predicted 791
5 SASI_Hs01_00191908 predicted 744
6 SASI_Hs01_00191909 predicted 795
7 SASI_Hs01_00191910 predicted 805
8 SASI_Hs01_00191911 predicted 807
9 SASI_Hs01_00191912 predicted 780
10 SASI_Hs01_00191913 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033319 predicted 778
2 SASI_Hs01_00033320 predicted 764
3 SASI_Hs01_00033321 predicted 727
4 SASI_Hs01_00033322 predicted 770
5 SASI_Hs01_00033323 predicted 722
6 SASI_Hs01_00033324 predicted 772
7 SASI_Hs01_00033325 predicted 773
8 SASI_Hs01_00033326 predicted 785
9 SASI_Hs01_00033327 predicted 760
10 SASI_Hs01_00033328 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056953 predicted 661
2 SASI_Hs01_00056954 predicted 649
3 SASI_Hs01_00056955 predicted 605
4 SASI_Hs01_00056956 predicted 655
5 SASI_Hs01_00056957 predicted 602
6 SASI_Hs01_00056958 predicted 651
7 SASI_Hs01_00056959 predicted 657
8 SASI_Hs01_00056960 predicted 669
9 SASI_Hs01_00056961 predicted 635
10 SASI_Hs01_00056962 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368323 predicted 304
2 SASI_Rn02_00368324 predicted 506
3 SASI_Rn02_00368325 predicted 511
4 SASI_Rn02_00368326 predicted 303
5 SASI_Rn02_00368327 predicted 474
6 SASI_Rn02_00368328 predicted 208
7 SASI_Rn02_00368329 predicted 535
8 SASI_Rn02_00368330 predicted 235
9 SASI_Rn02_00368331 predicted 497
10 SASI_Rn02_00368332 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143444 predicted 516
2 SASI_Mm01_00143445 predicted 219
3 SASI_Mm01_00143446 predicted 507
4 SASI_Mm01_00143447 predicted 209
5 SASI_Mm01_00143448 predicted 237
6 SASI_Mm01_00143449 predicted 469
7 SASI_Mm01_00143450 predicted 376
8 SASI_Mm01_00143451 predicted 304
9 SASI_Mm01_00143452 predicted 498
10 SASI_Mm01_00143453 predicted 467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017509
KLK15 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017509.2-148s21c1
Sequence:CCGGCTACGAGCGTGGACGCTTTAACTCGAGTTAAAGCGTCCACGCTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-83s1c1
Sequence:CCGGGATGGTGACAAGTTGCTGGAACTCGAGTTCCAGCAACTTGTCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-558s1c1
Sequence:CCGGCGGACACATCTTGTGACAAGACTCGAGTCTTGTCACAAGATGTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-516s1c1
Sequence:CCGGGTCTCCCAGATACGTTGCATTCTCGAGAATGCAACGTATCTGGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-347s1c1
Sequence:CCGGGACATCATGTTGCTGCGCCTACTCGAGTAGGCGCAGCAACATGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-745s1c1
Sequence:CCGGCTATACCAAAGTCTGCCACTACTCGAGTAGTGGCAGACTTTGGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017509.2-1005s21c1
Sequence:CCGGCAAGTTGCTCTGTAGGAATTTCTCGAGAAATTCCTACAGAGCAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017509.2-961s21c1
Sequence:CCGGGCTCAAGGTCACCTGTTTAATCTCGAGATTAAACAGGTGACCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017509
KLK15 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017509.2-148s21c1
Sequence:CCGGCTACGAGCGTGGACGCTTTAACTCGAGTTAAAGCGTCCACGCTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-83s1c1
Sequence:CCGGGATGGTGACAAGTTGCTGGAACTCGAGTTCCAGCAACTTGTCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-558s1c1
Sequence:CCGGCGGACACATCTTGTGACAAGACTCGAGTCTTGTCACAAGATGTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-516s1c1
Sequence:CCGGGTCTCCCAGATACGTTGCATTCTCGAGAATGCAACGTATCTGGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-347s1c1
Sequence:CCGGGACATCATGTTGCTGCGCCTACTCGAGTAGGCGCAGCAACATGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-745s1c1
Sequence:CCGGCTATACCAAAGTCTGCCACTACTCGAGTAGTGGCAGACTTTGGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017509.2-1005s21c1
Sequence:CCGGCAAGTTGCTCTGTAGGAATTTCTCGAGAAATTCCTACAGAGCAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017509.2-961s21c1
Sequence:CCGGGCTCAAGGTCACCTGTTTAATCTCGAGATTAAACAGGTGACCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017509
KLK15 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017509.2-148s21c1
Sequence:CCGGCTACGAGCGTGGACGCTTTAACTCGAGTTAAAGCGTCCACGCTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-83s1c1
Sequence:CCGGGATGGTGACAAGTTGCTGGAACTCGAGTTCCAGCAACTTGTCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-558s1c1
Sequence:CCGGCGGACACATCTTGTGACAAGACTCGAGTCTTGTCACAAGATGTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-516s1c1
Sequence:CCGGGTCTCCCAGATACGTTGCATTCTCGAGAATGCAACGTATCTGGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-347s1c1
Sequence:CCGGGACATCATGTTGCTGCGCCTACTCGAGTAGGCGCAGCAACATGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017509.2-745s1c1
Sequence:CCGGCTATACCAAAGTCTGCCACTACTCGAGTAGTGGCAGACTTTGGTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017509.2-1005s21c1
Sequence:CCGGCAAGTTGCTCTGTAGGAATTTCTCGAGAAATTCCTACAGAGCAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017509.2-961s21c1
Sequence:CCGGGCTCAAGGTCACCTGTTTAATCTCGAGATTAAACAGGTGACCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174865
KLK15 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 15
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-479s1c1
Sequence:CCGGGACTCCCTGATACGTTGCATTCTCGAGAATGCAACGTATCAGGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-123s1c1
Sequence:CCGGCCGGTTTAATTGTGGCGCTTTCTCGAGAAAGCGCCACAATTAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-303s1c1
Sequence:CCGGCCGCCATGACATTATGCTGTTCTCGAGAACAGCATAATGTCATGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-512s1c1
Sequence:CCGGGCATTATCTCTGAAGCATCTTCTCGAGAAGATGCTTCAGAGATAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-177s1c1
Sequence:CCGGCCACTGCCAAACCCGCTTCATCTCGAGATGAAGCGGGTTTGGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174865.1-100s21c1
Sequence:CCGGCAAGTAGCCCTCTTCGAACGTCTCGAGACGTTCGAAGAGGGCTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174865.1-215s21c1
Sequence:CCGGAGCACAATCTCCGCAAGTTCGCTCGAGCGAACTTGCGGAGATTGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174865
KLK15 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 15
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-479s1c1
Sequence:CCGGGACTCCCTGATACGTTGCATTCTCGAGAATGCAACGTATCAGGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-123s1c1
Sequence:CCGGCCGGTTTAATTGTGGCGCTTTCTCGAGAAAGCGCCACAATTAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-303s1c1
Sequence:CCGGCCGCCATGACATTATGCTGTTCTCGAGAACAGCATAATGTCATGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-512s1c1
Sequence:CCGGGCATTATCTCTGAAGCATCTTCTCGAGAAGATGCTTCAGAGATAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-177s1c1
Sequence:CCGGCCACTGCCAAACCCGCTTCATCTCGAGATGAAGCGGGTTTGGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174865.1-100s21c1
Sequence:CCGGCAAGTAGCCCTCTTCGAACGTCTCGAGACGTTCGAAGAGGGCTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174865.1-215s21c1
Sequence:CCGGAGCACAATCTCCGCAAGTTCGCTCGAGCGAACTTGCGGAGATTGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174865
KLK15 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 15
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-479s1c1
Sequence:CCGGGACTCCCTGATACGTTGCATTCTCGAGAATGCAACGTATCAGGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-123s1c1
Sequence:CCGGCCGGTTTAATTGTGGCGCTTTCTCGAGAAAGCGCCACAATTAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-303s1c1
Sequence:CCGGCCGCCATGACATTATGCTGTTCTCGAGAACAGCATAATGTCATGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-512s1c1
Sequence:CCGGGCATTATCTCTGAAGCATCTTCTCGAGAAGATGCTTCAGAGATAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174865.1-177s1c1
Sequence:CCGGCCACTGCCAAACCCGCTTCATCTCGAGATGAAGCGGGTTTGGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174865.1-100s21c1
Sequence:CCGGCAAGTAGCCCTCTTCGAACGTCTCGAGACGTTCGAAGAGGGCTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174865.1-215s21c1
Sequence:CCGGAGCACAATCTCCGCAAGTTCGCTCGAGCGAACTTGCGGAGATTGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)