EMAIL THIS PAGE TO A FRIEND

KLK1

kallikrein 1

53 Gene Product Result for
Synonyms: KLKR Klk6 hK1
Gene ID:
Human(3816) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. This protein is functionally conserved in its capacity to release the vasoactive peptide, Lys-bradykinin, from low molecular weight kininogen. [provided by RefSeq, Jul 2008]
Mouse(16612) kallikrein 1
Rat(24594) kallikrein 1
cow(493738) kallikrein 1
dog(403942) kallikrein 1
sheep(100048991) kallikrein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002257 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009591 MISSION® esiRNA esiRNA targeting human KLK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002257 Rosetta Predictions human pricing
NM_031523 Rosetta Predictions rat pricing
NM_010639 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063088 predicted 222
2 SASI_Hs01_00063089 predicted 421
3 SASI_Hs01_00063090 predicted 438
4 SASI_Hs01_00063091 predicted 264
5 SASI_Hs01_00063092 predicted 220
6 SASI_Hs01_00063093 predicted 259
7 SASI_Hs01_00063094 predicted 408
8 SASI_Hs01_00063096 predicted 226
9 SASI_Hs01_00063097 predicted 371
10 SASI_Hs02_00333513 predicted 512
11 SASI_Hs01_00063095 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081012 predicted 266
2 SASI_Rn01_00081013 predicted 515
3 SASI_Rn01_00081014 predicted 511
4 SASI_Rn01_00081015 predicted 521
5 SASI_Rn01_00081016 predicted 337
6 SASI_Rn01_00081017 predicted 229
7 SASI_Rn01_00081018 predicted 531
8 SASI_Rn01_00081019 predicted 337
9 SASI_Rn01_00081020 predicted 220
10 SASI_Rn01_00081021 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183725 predicted 512
2 SASI_Mm02_00318989 predicted 188
3 SASI_Mm02_00318990 predicted 754
4 SASI_Mm02_00318991 predicted 759
5 SASI_Mm01_00183716 predicted 383
6 SASI_Mm01_00183717 predicted 311
7 SASI_Mm01_00183718 predicted 372
8 SASI_Mm01_00183719 predicted 521
9 SASI_Mm01_00183720 predicted 608
10 SASI_Mm01_00183721 predicted 518
11 SASI_Mm01_00183722 predicted 596
12 SASI_Mm01_00183723 predicted 593
13 SASI_Mm01_00183724 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010639
KLK1 MISSION shRNA Bacterial Glycerol Stock
kallikrein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-516s1c1
Sequence:CCGGGCAGCATTACACCCGTCAAATCTCGAGATTTGACGGGTGTAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-235s1c1
Sequence:CCGGCCACTGCCATAATGACAAGTACTCGAGTACTTGTCATTATGGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-380s1c1
Sequence:CCGGCCTGAGGATGACTACAGCAATCTCGAGATTGCTGTAGTCATCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-111s1c1
Sequence:CCGGCTCGAATTGTTGGAGGATTTACTCGAGTAAATCCTCCAACAATTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-530s1c1
Sequence:CCGGGTCAAATATGAATACCCAGATCTCGAGATCTGGGTATTCATATTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010639
KLK1 MISSION shRNA shRNA Plasmid DNA
kallikrein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-516s1c1
Sequence:CCGGGCAGCATTACACCCGTCAAATCTCGAGATTTGACGGGTGTAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-235s1c1
Sequence:CCGGCCACTGCCATAATGACAAGTACTCGAGTACTTGTCATTATGGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-380s1c1
Sequence:CCGGCCTGAGGATGACTACAGCAATCTCGAGATTGCTGTAGTCATCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-111s1c1
Sequence:CCGGCTCGAATTGTTGGAGGATTTACTCGAGTAAATCCTCCAACAATTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-530s1c1
Sequence:CCGGGTCAAATATGAATACCCAGATCTCGAGATCTGGGTATTCATATTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010639
KLK1 MISSION shRNA Lentiviral Transduction Particles
kallikrein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-516s1c1
Sequence:CCGGGCAGCATTACACCCGTCAAATCTCGAGATTTGACGGGTGTAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-235s1c1
Sequence:CCGGCCACTGCCATAATGACAAGTACTCGAGTACTTGTCATTATGGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-380s1c1
Sequence:CCGGCCTGAGGATGACTACAGCAATCTCGAGATTGCTGTAGTCATCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-111s1c1
Sequence:CCGGCTCGAATTGTTGGAGGATTTACTCGAGTAAATCCTCCAACAATTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010639.5-530s1c1
Sequence:CCGGGTCAAATATGAATACCCAGATCTCGAGATCTGGGTATTCATATTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002257
KLK1 MISSION shRNA Bacterial Glycerol Stock
kallikrein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-515s1c1
Sequence:CCGGGCAGCATCGAACCAGAGAATTCTCGAGAATTCTCTGGTTCGATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-424s1c1
Sequence:CCGGCCTGCTGATACCATCACAGATCTCGAGATCTGTGATGGTATCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-229s1c1
Sequence:CCGGGCTCATTGCATCAGCGACAATCTCGAGATTGTCGCTGATGCAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-576s1c1
Sequence:CCGGCCTGCCTAATGATGAGTGCAACTCGAGTTGCACTCATCATTAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-272s1c1
Sequence:CCGGACAACTTGTTTGACGACGAAACTCGAGTTTCGTCGTCAAACAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002257.2-662s21c1
Sequence:CCGGACACCTGTGTGGGTGATTCAGCTCGAGCTGAATCACCCACACAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002257.2-155s21c1
Sequence:CCGGAGGCGGCTCTGTACCATTTCACTCGAGTGAAATGGTACAGAGCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002257.2-553s21c1
Sequence:CCGGCTCCAGTGTGTGGACCTCAAACTCGAGTTTGAGGTCCACACACTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002257
KLK1 MISSION shRNA shRNA Plasmid DNA
kallikrein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-515s1c1
Sequence:CCGGGCAGCATCGAACCAGAGAATTCTCGAGAATTCTCTGGTTCGATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-424s1c1
Sequence:CCGGCCTGCTGATACCATCACAGATCTCGAGATCTGTGATGGTATCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-229s1c1
Sequence:CCGGGCTCATTGCATCAGCGACAATCTCGAGATTGTCGCTGATGCAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-576s1c1
Sequence:CCGGCCTGCCTAATGATGAGTGCAACTCGAGTTGCACTCATCATTAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-272s1c1
Sequence:CCGGACAACTTGTTTGACGACGAAACTCGAGTTTCGTCGTCAAACAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002257.2-662s21c1
Sequence:CCGGACACCTGTGTGGGTGATTCAGCTCGAGCTGAATCACCCACACAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002257.2-155s21c1
Sequence:CCGGAGGCGGCTCTGTACCATTTCACTCGAGTGAAATGGTACAGAGCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002257.2-553s21c1
Sequence:CCGGCTCCAGTGTGTGGACCTCAAACTCGAGTTTGAGGTCCACACACTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002257
KLK1 MISSION shRNA Lentiviral Transduction Particles
kallikrein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-515s1c1
Sequence:CCGGGCAGCATCGAACCAGAGAATTCTCGAGAATTCTCTGGTTCGATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-424s1c1
Sequence:CCGGCCTGCTGATACCATCACAGATCTCGAGATCTGTGATGGTATCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-229s1c1
Sequence:CCGGGCTCATTGCATCAGCGACAATCTCGAGATTGTCGCTGATGCAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-576s1c1
Sequence:CCGGCCTGCCTAATGATGAGTGCAACTCGAGTTGCACTCATCATTAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002257.2-272s1c1
Sequence:CCGGACAACTTGTTTGACGACGAAACTCGAGTTTCGTCGTCAAACAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002257.2-662s21c1
Sequence:CCGGACACCTGTGTGGGTGATTCAGCTCGAGCTGAATCACCCACACAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002257.2-155s21c1
Sequence:CCGGAGGCGGCTCTGTACCATTTCACTCGAGTGAAATGGTACAGAGCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002257.2-553s21c1
Sequence:CCGGCTCCAGTGTGTGGACCTCAAACTCGAGTTTGAGGTCCACACACTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)