EMAIL THIS PAGE TO A FRIEND

Klk1b22

12 Gene Product Result for
Species: Mouse Klk1b22(13646)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU185441 MISSION® esiRNA targeting mouse Klk1b22 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_010114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167056 predicted 479
2 SASI_Mm01_00167057 predicted 531
3 SASI_Mm01_00167058 predicted 571
4 SASI_Mm01_00167059 predicted 555
5 SASI_Mm01_00167060 predicted 555
6 SASI_Mm01_00167061 predicted 558
7 SASI_Mm01_00167062 predicted 484
8 SASI_Mm01_00167064 predicted 567
9 SASI_Mm01_00167065 predicted 211
10 SASI_Mm02_00317829 predicted 208
11 SASI_Mm01_00167063 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010114
Klk1b22 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-486s1c1
Sequence:CCGGGCAGCATTAACCAGTTAATATCTCGAGATATTAACTGGTTAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-147s1c1
Sequence:CCGGACTACTTAGATGAGTACCTATCTCGAGATAGGTACTCATCTAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-547s1c1
Sequence:CCGGCCATCCTAATGAGGTCTGTGTCTCGAGACACAGACCTCATTAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-572s1c1
Sequence:CCGGGCCCATATACTGAAGGTGACACTCGAGTGTCACCTTCAGTATATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-213s1c1
Sequence:CCGGACTGCTATGAAGACAAGTATACTCGAGTATACTTGTCTTCATAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010114
Klk1b22 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-486s1c1
Sequence:CCGGGCAGCATTAACCAGTTAATATCTCGAGATATTAACTGGTTAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-147s1c1
Sequence:CCGGACTACTTAGATGAGTACCTATCTCGAGATAGGTACTCATCTAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-547s1c1
Sequence:CCGGCCATCCTAATGAGGTCTGTGTCTCGAGACACAGACCTCATTAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-572s1c1
Sequence:CCGGGCCCATATACTGAAGGTGACACTCGAGTGTCACCTTCAGTATATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-213s1c1
Sequence:CCGGACTGCTATGAAGACAAGTATACTCGAGTATACTTGTCTTCATAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010114
Klk1b22 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-486s1c1
Sequence:CCGGGCAGCATTAACCAGTTAATATCTCGAGATATTAACTGGTTAATGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000092039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-147s1c1
Sequence:CCGGACTACTTAGATGAGTACCTATCTCGAGATAGGTACTCATCTAAGTAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000092042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-547s1c1
Sequence:CCGGCCATCCTAATGAGGTCTGTGTCTCGAGACACAGACCTCATTAGGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000092040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-572s1c1
Sequence:CCGGGCCCATATACTGAAGGTGACACTCGAGTGTCACCTTCAGTATATGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000092041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010114.1-213s1c1
Sequence:CCGGACTGCTATGAAGACAAGTATACTCGAGTATACTTGTCTTCATAGCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???