EMAIL THIS PAGE TO A FRIEND

Klk1b26

12 Gene Product Result for
Species: Mouse Klk1b26(16618)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU164771 MISSION® esiRNA targeting mouse Klk1b26 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_010644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096571 predicted 587
2 SASI_Mm01_00096572 predicted 587
3 SASI_Mm01_00096573 predicted 587
4 SASI_Mm01_00096576 predicted 586
5 SASI_Mm01_00096579 predicted 593
6 SASI_Mm02_00319012 predicted 716
7 SASI_Mm01_00096574 predicted 538
8 SASI_Mm01_00096575 predicted 360
9 SASI_Mm01_00096577 predicted 513
10 SASI_Mm01_00096578 predicted 608
11 SASI_Mm01_00096580 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010644
Klk1b26 MISSION shRNA Bacterial Glycerol Stock
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000032114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-120s1c1
Sequence:CCGGTGGAGGATTTAACTGTGAGAACTCGAGTTCTCACAGTTAAATCCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-698s1c1
Sequence:CCGGGTGATGGTATTCTCCAAGGAACTCGAGTTCCTTGGAGAATACCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-718s1c1
Sequence:CCGGACCACATCAAATGGCCCTGAACTCGAGTTCAGGGCCATTTGATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-342s1c1
Sequence:CCGGCTTCAACATGAGCCTCCTGATCTCGAGATCAGGAGGCTCATGTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010644
Klk1b26 MISSION shRNA shRNA Plasmid DNA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000032114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-120s1c1
Sequence:CCGGTGGAGGATTTAACTGTGAGAACTCGAGTTCTCACAGTTAAATCCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-698s1c1
Sequence:CCGGGTGATGGTATTCTCCAAGGAACTCGAGTTCCTTGGAGAATACCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-718s1c1
Sequence:CCGGACCACATCAAATGGCCCTGAACTCGAGTTCAGGGCCATTTGATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-342s1c1
Sequence:CCGGCTTCAACATGAGCCTCCTGATCTCGAGATCAGGAGGCTCATGTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010644
Klk1b26 MISSION shRNA Lentiviral Transduction Particles
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000032114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-120s1c1
Sequence:CCGGTGGAGGATTTAACTGTGAGAACTCGAGTTCTCACAGTTAAATCCTCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-698s1c1
Sequence:CCGGGTGATGGTATTCTCCAAGGAACTCGAGTTCCTTGGAGAATACCATCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-718s1c1
Sequence:CCGGACCACATCAAATGGCCCTGAACTCGAGTTCAGGGCCATTTGATGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010644.1-342s1c1
Sequence:CCGGCTTCAACATGAGCCTCCTGATCTCGAGATCAGGAGGCTCATGTTGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???