EMAIL THIS PAGE TO A FRIEND

KLK2

kallikrein-related peptidase 2

173 Gene Product Result for
Synonyms: KLK2A2 hGK-1 hK2
Species: Human KLK2(3817), dog KLK2(403967), domestic guinea pig Klk2(100716976)
UniProtKB ID: P20151, B4DU93, B4DUB0, F5H8L3, Q15946, Q9UJZ9
Gene ID:
Human(3817) Summary: This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Jan 2012]
dog(403967) kallikrein-related peptidase 2
domestic guinea pig(100716976) kallikrein-related peptidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005551 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077901 MISSION® esiRNA esiRNA human KLK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002231 Rosetta Predictions human pricing
NM_001002232 Rosetta Predictions human pricing
NM_005551 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209144 predicted 1052
2 SASI_Hs01_00209145 predicted 1054
3 SASI_Hs02_00304111 predicted 1050
4 SASI_Hs02_00304112 predicted 367
5 SASI_Hs02_00304113 predicted 418
6 SASI_Hs01_00209149 predicted 1148
7 SASI_Hs01_00209151 predicted 982
8 SASI_Hs01_00209152 predicted 926
9 SASI_Hs02_00304114 predicted 1117
10 SASI_Hs01_00209146 predicted 1039
11 SASI_Hs01_00209143 predicted 236
12 SASI_Hs01_00209147 predicted 1141
13 SASI_Hs01_00209148 predicted 1069
14 SASI_Hs01_00209150 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134310 predicted 1040
2 SASI_Hs01_00134311 predicted 1033
3 SASI_Hs01_00134312 predicted 974
4 SASI_Hs01_00134313 predicted 270
5 SASI_Hs01_00134314 predicted 891
6 SASI_Hs01_00134315 predicted 758
7 SASI_Hs01_00134316 predicted 367
8 SASI_Hs01_00134317 predicted 429
9 SASI_Hs01_00134318 predicted 868
10 SASI_Hs01_00134319 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234131 predicted 1016
2 SASI_Hs01_00234132 predicted 1017
3 SASI_Hs01_00234134 predicted 1009
4 SASI_Hs01_00234135 predicted 1194
5 SASI_Hs02_00339796 predicted 360
6 SASI_Hs02_00339797 predicted 419
7 SASI_Hs01_00234137 predicted 1117
8 SASI_Hs01_00234139 predicted 947
9 SASI_Hs01_00234140 predicted 1204
10 SASI_Hs02_00339798 predicted 887
11 SASI_Hs01_00234133 predicted 1010
12 SASI_Hs01_00234136 predicted 1098
13 SASI_Hs01_00234138 predicted 1121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005551
KLK2 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-569s1c1
Sequence:CCGGCCATCTCCTGTCCAATGACATCTCGAGATGTCATTGGACAGGAGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-593s1c1
Sequence:CCGGTGCTAGAGCTTACTCTGAGAACTCGAGTTCTCAGAGTAAGCTCTAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-273s1c1
Sequence:CCGGCACAACCTGTTTGAGCCTGAACTCGAGTTCAGGCTCAAACAGGTTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-426s1c1
Sequence:CCGGCCTGCCAAGATCACAGATGTTCTCGAGAACATCTGTGATCTTGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-160s1c1
Sequence:CCGGTGGCTGTGTACAGTCATGGATCTCGAGATCCATGACTGTACACAGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005551
KLK2 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-569s1c1
Sequence:CCGGCCATCTCCTGTCCAATGACATCTCGAGATGTCATTGGACAGGAGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-593s1c1
Sequence:CCGGTGCTAGAGCTTACTCTGAGAACTCGAGTTCTCAGAGTAAGCTCTAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-273s1c1
Sequence:CCGGCACAACCTGTTTGAGCCTGAACTCGAGTTCAGGCTCAAACAGGTTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-426s1c1
Sequence:CCGGCCTGCCAAGATCACAGATGTTCTCGAGAACATCTGTGATCTTGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-160s1c1
Sequence:CCGGTGGCTGTGTACAGTCATGGATCTCGAGATCCATGACTGTACACAGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005551
KLK2 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-569s1c1
Sequence:CCGGCCATCTCCTGTCCAATGACATCTCGAGATGTCATTGGACAGGAGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-593s1c1
Sequence:CCGGTGCTAGAGCTTACTCTGAGAACTCGAGTTCTCAGAGTAAGCTCTAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-273s1c1
Sequence:CCGGCACAACCTGTTTGAGCCTGAACTCGAGTTCAGGCTCAAACAGGTTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-426s1c1
Sequence:CCGGCCTGCCAAGATCACAGATGTTCTCGAGAACATCTGTGATCTTGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005551.2-160s1c1
Sequence:CCGGTGGCTGTGTACAGTCATGGATCTCGAGATCCATGACTGTACACAGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)