EMAIL THIS PAGE TO A FRIEND

KLK3

kallikrein-related peptidase 3

81 Gene Product Result for
Synonyms: APS KLK2A1 PSA hK3
Species: Human KLK3(354)
Gene ID:
Human(354) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its protein product is a protease present in seminal plasma. It is thought to function normally in the liquefaction of seminal coagulum, presumably by hydrolysis of the high molecular mass seminal vesicle protein. Serum level of this protein, called PSA in the clinical setting, is useful in the diagnosis and monitoring of prostatic carcinoma. Alternate splicing of this gene generates several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001648 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156951 MISSION® esiRNA esiRNA human KLK3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030047 Rosetta Predictions human pricing
NM_001030048 Rosetta Predictions human pricing
NM_001030049 Rosetta Predictions human pricing
NM_001030050 Rosetta Predictions human pricing
NM_001648 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144107 predicted 1006
2 SASI_Hs01_00144108 predicted 609
3 SASI_Hs01_00144109 predicted 1025
4 SASI_Hs01_00144111 predicted 739
5 SASI_Hs01_00144113 predicted 1190
6 SASI_Hs01_00144114 predicted 1064
7 SASI_Hs01_00144115 predicted 1064
8 SASI_Hs01_00144116 predicted 563
9 SASI_Hs02_00307635 predicted 440
10 SASI_Hs02_00307636 predicted 975
11 SASI_Hs01_00144110 predicted 346
12 SASI_Hs01_00144112 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095318 predicted 822
2 SASI_Hs01_00095319 predicted 847
3 SASI_Hs01_00095320 predicted 765
4 SASI_Hs01_00095321 predicted 832
5 SASI_Hs01_00095322 predicted 836
6 SASI_Hs01_00095323 predicted 1028
7 SASI_Hs01_00095324 predicted 775
8 SASI_Hs01_00095325 predicted 900
9 SASI_Hs01_00095326 predicted 766
10 SASI_Hs01_00095327 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075214 predicted 835
2 SASI_Hs01_00075215 predicted 850
3 SASI_Hs01_00075216 predicted 772
4 SASI_Hs01_00075217 predicted 838
5 SASI_Hs01_00075218 predicted 834
6 SASI_Hs01_00075219 predicted 1034
7 SASI_Hs01_00075220 predicted 779
8 SASI_Hs01_00075221 predicted 908
9 SASI_Hs01_00075222 predicted 774
10 SASI_Hs01_00075223 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033949 predicted 219
2 SASI_Hs01_00033950 predicted 277
3 SASI_Hs01_00033951 predicted 224
4 SASI_Hs01_00033952 predicted 275
5 SASI_Hs01_00033953 predicted 270
6 SASI_Hs01_00033954 predicted 288
7 SASI_Hs01_00033955 predicted 224
8 SASI_Hs01_00033956 predicted 226
9 SASI_Hs01_00033957 predicted 277
10 SASI_Hs01_00033958 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142930 predicted 958
2 SASI_Hs01_00142931 predicted 974
3 SASI_Hs01_00142932 predicted 894
4 SASI_Hs01_00142933 predicted 966
5 SASI_Hs01_00142934 predicted 956
6 SASI_Hs01_00142935 predicted 1163
7 SASI_Hs01_00142936 predicted 905
8 SASI_Hs01_00142937 predicted 1025
9 SASI_Hs01_00142938 predicted 897
10 SASI_Hs01_00142939 predicted 1040
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001648
KLK3 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001648.2-1037s1c1
Sequence:CCGGGCCTGGAGACATATCACTCAACTCGAGTTGAGTGATATGTCTCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-558s1c1
Sequence:CCGGTGTGTGGACCTCCATGTTATTCTCGAGAATAACATGGAGGTCCACACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-350s1c1
Sequence:CCGGGAGCCTCCTGAAGAATCGATTCTCGAGAATCGATTCTTCAGGAGGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-564s1c1
Sequence:CCGGGACCTCCATGTTATTTCCAATCTCGAGATTGGAAATAACATGGAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-273s1c1
Sequence:CCGGCACAGCCTGTTTCATCCTGAACTCGAGTTCAGGATGAAACAGGCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001648.2-593s21c1
Sequence:CCGGTGCGCAAGTTCACCCTCAGAACTCGAGTTCTGAGGGTGAACTTGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001648.2-1062s21c1
Sequence:CCGGTCTGAGGACACAGATAGGATGCTCGAGCATCCTATCTGTGTCCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001648.2-981s21c1
Sequence:CCGGGTGTTTCTTAAATGGTGTAATCTCGAGATTACACCATTTAAGAAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001648
KLK3 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001648.2-1037s1c1
Sequence:CCGGGCCTGGAGACATATCACTCAACTCGAGTTGAGTGATATGTCTCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-558s1c1
Sequence:CCGGTGTGTGGACCTCCATGTTATTCTCGAGAATAACATGGAGGTCCACACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-350s1c1
Sequence:CCGGGAGCCTCCTGAAGAATCGATTCTCGAGAATCGATTCTTCAGGAGGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-564s1c1
Sequence:CCGGGACCTCCATGTTATTTCCAATCTCGAGATTGGAAATAACATGGAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-273s1c1
Sequence:CCGGCACAGCCTGTTTCATCCTGAACTCGAGTTCAGGATGAAACAGGCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001648.2-593s21c1
Sequence:CCGGTGCGCAAGTTCACCCTCAGAACTCGAGTTCTGAGGGTGAACTTGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001648.2-1062s21c1
Sequence:CCGGTCTGAGGACACAGATAGGATGCTCGAGCATCCTATCTGTGTCCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001648.2-981s21c1
Sequence:CCGGGTGTTTCTTAAATGGTGTAATCTCGAGATTACACCATTTAAGAAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001648
KLK3 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001648.2-1037s1c1
Sequence:CCGGGCCTGGAGACATATCACTCAACTCGAGTTGAGTGATATGTCTCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-558s1c1
Sequence:CCGGTGTGTGGACCTCCATGTTATTCTCGAGAATAACATGGAGGTCCACACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-350s1c1
Sequence:CCGGGAGCCTCCTGAAGAATCGATTCTCGAGAATCGATTCTTCAGGAGGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-564s1c1
Sequence:CCGGGACCTCCATGTTATTTCCAATCTCGAGATTGGAAATAACATGGAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001648.2-273s1c1
Sequence:CCGGCACAGCCTGTTTCATCCTGAACTCGAGTTCAGGATGAAACAGGCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001648.2-593s21c1
Sequence:CCGGTGCGCAAGTTCACCCTCAGAACTCGAGTTCTGAGGGTGAACTTGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001648.2-1062s21c1
Sequence:CCGGTCTGAGGACACAGATAGGATGCTCGAGCATCCTATCTGTGTCCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001648.2-981s21c1
Sequence:CCGGGTGTTTCTTAAATGGTGTAATCTCGAGATTACACCATTTAAGAAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)