EMAIL THIS PAGE TO A FRIEND

KLK4

kallikrein-related peptidase 4

65 Gene Product Result for
Synonyms: AI2A1 ARM1 EMSP EMSP1 KLK-L1 PRSS17 PSTS kallikrein
UniProtKB ID: Q9Y5K2, Q4VB16, Q9GZL6, Q9UBJ6
Gene ID:
Human(9622) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In some tissues its expression is hormonally regulated. The expression pattern of a similar mouse protein in murine developing teeth supports a role for the protein in the degradation of enamel proteins. Alternate splice variants for this gene have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(56640) kallikrein related-peptidase 4 (prostase, enamel matrix, prostate)
Rat(408210) kallikrein-related peptidase 4
domestic cat(101089560) kallikrein-related peptidase 4
cow(507800) kallikrein-related peptidase 4
dog(484354) kallikrein-related peptidase 4
naked mole-rat(101718095) kallikrein-related peptidase 4
sheep(101114802) kallikrein-related peptidase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154331 MISSION® esiRNA esiRNA human KLK4 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
NC010 Nerve Growth Factor 7.0s pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004917 Rosetta Predictions human pricing
NM_001004101 Rosetta Predictions rat pricing
NM_019928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126919 predicted 364
2 SASI_Hs01_00126920 predicted 493
3 SASI_Hs01_00126921 predicted 310
4 SASI_Hs01_00126922 predicted 346
5 SASI_Hs01_00126923 predicted 515
6 SASI_Hs01_00126925 predicted 493
7 SASI_Hs01_00126926 predicted 399
8 SASI_Hs01_00126927 predicted 332
9 SASI_Hs02_00338582 predicted 250
10 SASI_Hs02_00338583 predicted 206
11 SASI_Hs01_00126918 predicted 211
12 SASI_Hs01_00126924 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198154 predicted 381
2 SASI_Rn01_00033809 predicted 345
3 SASI_Rn01_00033810 predicted 359
4 SASI_Rn01_00033811 predicted 503
5 SASI_Rn01_00033812 predicted 314
6 SASI_Rn01_00033814 predicted 310
7 SASI_Rn01_00033815 predicted 501
8 SASI_Rn01_00033816 predicted 526
9 SASI_Rn01_00033817 predicted 318
10 SASI_Rn01_00033818 predicted 506
11 SASI_Rn01_00033813 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113275 predicted 794
2 SASI_Mm01_00113276 predicted 398
3 SASI_Mm01_00113277 predicted 371
4 SASI_Mm01_00113278 predicted 701
5 SASI_Mm01_00113279 predicted 386
6 SASI_Mm01_00113280 predicted 838
7 SASI_Mm01_00113281 predicted 221
8 SASI_Mm01_00113282 predicted 820
9 SASI_Mm01_00113283 predicted 771
10 SASI_Mm01_00113284 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004917
KLK4 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004917.3-527s21c1
Sequence:CCGGAGGTCTGCAGTAAGCTCTATGCTCGAGCATAGAGCTTACTGCAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004917.3-308s21c1
Sequence:CCGGTACGGCACCCAGAGTACAACACTCGAGTGTTGTACTCTGGGTGCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-87s1c1
Sequence:CCGGCCAAATCATAAACGGCGAGGACTCGAGTCCTCGCCGTTTATGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-630s1c1
Sequence:CCGGCCTGATCTGCAACGGGTACTTCTCGAGAAGTACCCGTTGCAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-375s1c1
Sequence:CCGGCGTGTCCGAGTCTGACACCATCTCGAGATGGTGTCAGACTCGGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-721s1c1
Sequence:CCGGTGCAAATTCACTGAGTGGATACTCGAGTATCCACTCAGTGAATTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-353s1c1
Sequence:CCGGTGCTCATCAAGTTGGACGAATCTCGAGATTCGTCCAACTTGATGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004917.3-771s21c1
Sequence:CCGGGGGACTGGGAACCCATGAAATCTCGAGATTTCATGGGTTCCCAGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004917
KLK4 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004917.3-527s21c1
Sequence:CCGGAGGTCTGCAGTAAGCTCTATGCTCGAGCATAGAGCTTACTGCAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004917.3-308s21c1
Sequence:CCGGTACGGCACCCAGAGTACAACACTCGAGTGTTGTACTCTGGGTGCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-87s1c1
Sequence:CCGGCCAAATCATAAACGGCGAGGACTCGAGTCCTCGCCGTTTATGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-630s1c1
Sequence:CCGGCCTGATCTGCAACGGGTACTTCTCGAGAAGTACCCGTTGCAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-375s1c1
Sequence:CCGGCGTGTCCGAGTCTGACACCATCTCGAGATGGTGTCAGACTCGGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-721s1c1
Sequence:CCGGTGCAAATTCACTGAGTGGATACTCGAGTATCCACTCAGTGAATTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-353s1c1
Sequence:CCGGTGCTCATCAAGTTGGACGAATCTCGAGATTCGTCCAACTTGATGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004917.3-771s21c1
Sequence:CCGGGGGACTGGGAACCCATGAAATCTCGAGATTTCATGGGTTCCCAGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004917
KLK4 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004917.3-527s21c1
Sequence:CCGGAGGTCTGCAGTAAGCTCTATGCTCGAGCATAGAGCTTACTGCAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004917.3-308s21c1
Sequence:CCGGTACGGCACCCAGAGTACAACACTCGAGTGTTGTACTCTGGGTGCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-87s1c1
Sequence:CCGGCCAAATCATAAACGGCGAGGACTCGAGTCCTCGCCGTTTATGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-630s1c1
Sequence:CCGGCCTGATCTGCAACGGGTACTTCTCGAGAAGTACCCGTTGCAGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-375s1c1
Sequence:CCGGCGTGTCCGAGTCTGACACCATCTCGAGATGGTGTCAGACTCGGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-721s1c1
Sequence:CCGGTGCAAATTCACTGAGTGGATACTCGAGTATCCACTCAGTGAATTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004917.2-353s1c1
Sequence:CCGGTGCTCATCAAGTTGGACGAATCTCGAGATTCGTCCAACTTGATGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004917.3-771s21c1
Sequence:CCGGGGGACTGGGAACCCATGAAATCTCGAGATTTCATGGGTTCCCAGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019928
KLK4 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-795s1c1
Sequence:CCGGCCAGACCATCATTCAGACAAACTCGAGTTTGTCTGAATGATGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-194s1c1
Sequence:CCGGCACTGTTCTCAGAAGACGGTTCTCGAGAACCGTCTTCTGAGAACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-423s1c1
Sequence:CCGGCGAGTCAGTGATAGAGTCTAACTCGAGTTAGACTCTATCACTGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-371s1c1
Sequence:CCGGCCAACTTCAACGATCCTTCTTCTCGAGAAGAAGGATCGTTGAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-762s1c1
Sequence:CCGGCTACACCAATCTCTGCAAGTTCTCGAGAACTTGCAGAGATTGGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019928
KLK4 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-795s1c1
Sequence:CCGGCCAGACCATCATTCAGACAAACTCGAGTTTGTCTGAATGATGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-194s1c1
Sequence:CCGGCACTGTTCTCAGAAGACGGTTCTCGAGAACCGTCTTCTGAGAACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-423s1c1
Sequence:CCGGCGAGTCAGTGATAGAGTCTAACTCGAGTTAGACTCTATCACTGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-371s1c1
Sequence:CCGGCCAACTTCAACGATCCTTCTTCTCGAGAAGAAGGATCGTTGAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-762s1c1
Sequence:CCGGCTACACCAATCTCTGCAAGTTCTCGAGAACTTGCAGAGATTGGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019928
KLK4 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-795s1c1
Sequence:CCGGCCAGACCATCATTCAGACAAACTCGAGTTTGTCTGAATGATGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-194s1c1
Sequence:CCGGCACTGTTCTCAGAAGACGGTTCTCGAGAACCGTCTTCTGAGAACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-423s1c1
Sequence:CCGGCGAGTCAGTGATAGAGTCTAACTCGAGTTAGACTCTATCACTGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-371s1c1
Sequence:CCGGCCAACTTCAACGATCCTTCTTCTCGAGAAGAAGGATCGTTGAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019928.1-762s1c1
Sequence:CCGGCTACACCAATCTCTGCAAGTTCTCGAGAACTTGCAGAGATTGGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)