EMAIL THIS PAGE TO A FRIEND

KLK6

kallikrein-related peptidase 6

104 Gene Product Result for
Synonyms: Bssp Klk7 PRSS18 PRSS9 SP59 hK6
UniProtKB ID: Q92876, A6NJA1, A8MW09, Q6H301
Gene ID:
Human(5653) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. The encoded enzyme is regulated by steroid hormones. In tissue culture, the enzyme has been found to generate amyloidogenic fragments from the amyloid precursor protein, suggesting a potential for involvement in Alzheimer's disease. Multiple alternatively spliced transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(19144) kallikrein related-peptidase 6
Rat(29245) kallikrein related-peptidase 6
domestic guinea pig(100716801) kallikrein-related peptidase 6
naked mole-rat(101716716) kallikrein-related peptidase 6
sheep(101113520) kallikrein-related peptidase 6
cow(532677) kallikrein-related peptidase 6
domestic cat(101088379) kallikrein-related peptidase 6
dog(476402) kallikrein-related peptidase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002774 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043251 MISSION® esiRNA esiRNA human KLK6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012964 Rosetta Predictions human pricing
NM_001012965 Rosetta Predictions human pricing
NM_001012966 Rosetta Predictions human pricing
NM_002774 Rosetta Predictions human pricing
NM_019175 Rosetta Predictions rat pricing
NM_011177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306250 predicted 599
2 SASI_Hs01_00039212 predicted 710
3 SASI_Hs01_00039213 predicted 1086
4 SASI_Hs02_00306251 predicted 738
5 SASI_Hs01_00039214 predicted 686
6 SASI_Hs02_00306252 predicted 531
7 SASI_Hs01_00039216 predicted 693
8 SASI_Hs02_00306253 predicted 703
9 SASI_Hs02_00306254 predicted 531
10 SASI_Hs01_00039219 predicted 947
11 SASI_Hs01_00039211 predicted 1000
12 SASI_Hs01_00039215 predicted 788
13 SASI_Hs01_00039217 predicted 699
14 SASI_Hs01_00039218 predicted 1045
15 SASI_Hs01_00039220 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106706 predicted 942
2 SASI_Hs02_00306255 predicted 555
3 SASI_Hs01_00106707 predicted 668
4 SASI_Hs01_00106708 predicted 1034
5 SASI_Hs01_00106709 predicted 637
6 SASI_Hs01_00106711 predicted 643
7 SASI_Hs02_00306256 predicted 652
8 SASI_Hs01_00106712 predicted 639
9 SASI_Hs01_00106713 predicted 997
10 SASI_Hs01_00106714 predicted 890
11 SASI_Hs01_00106710 predicted 736
12 SASI_Hs01_00106715 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240426 predicted 841
2 SASI_Hs01_00240427 predicted 561
3 SASI_Hs01_00240428 predicted 537
4 SASI_Hs01_00240429 predicted 625
5 SASI_Hs01_00240430 predicted 544
6 SASI_Hs01_00240431 predicted 536
7 SASI_Hs01_00240432 predicted 786
8 SASI_Hs01_00240433 predicted 790
9 SASI_Hs01_00240434 predicted 826
10 SASI_Hs01_00240435 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334402 predicted 582
2 SASI_Hs01_00073202 predicted 693
3 SASI_Hs01_00073203 predicted 1070
4 SASI_Hs02_00334403 predicted 721
5 SASI_Hs01_00073204 predicted 673
6 SASI_Hs02_00334404 predicted 515
7 SASI_Hs01_00073206 predicted 680
8 SASI_Hs02_00334405 predicted 682
9 SASI_Hs02_00334406 predicted 520
10 SASI_Hs01_00073209 predicted 926
11 SASI_Hs01_00073201 predicted 986
12 SASI_Hs01_00073205 predicted 763
13 SASI_Hs01_00073207 predicted 678
14 SASI_Hs01_00073208 predicted 1035
15 SASI_Hs01_00073210 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072246 predicted 806
2 SASI_Rn01_00072247 predicted 545
3 SASI_Rn01_00072248 predicted 501
4 SASI_Rn01_00072249 predicted 842
5 SASI_Rn01_00072251 predicted 312
6 SASI_Rn01_00072252 predicted 429
7 SASI_Rn01_00072253 predicted 456
8 SASI_Rn01_00072254 predicted 755
9 SASI_Rn02_00261965 predicted 216
10 SASI_Rn01_00072255 predicted 400
11 SASI_Rn01_00072250 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099425 predicted 347
2 SASI_Mm01_00099426 predicted 875
3 SASI_Mm01_00099427 predicted 245
4 SASI_Mm01_00099428 predicted 529
5 SASI_Mm01_00099429 predicted 466
6 SASI_Mm01_00099430 predicted 468
7 SASI_Mm02_00320058 predicted 252
8 SASI_Mm01_00099431 predicted 464
9 SASI_Mm01_00099432 predicted 292
10 SASI_Mm01_00099433 predicted 490
11 SASI_Mm01_00099434 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002774
KLK6 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002774.3-1256s21c1
Sequence:CCGGACCCTTCCACACGTTTGATTTCTCGAGAAATCAAACGTGTGGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002774.3-1077s21c1
Sequence:CCGGCTCTGACCCTGATGCTTAATACTCGAGTATTAAGCATCAGGGTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002774.3-676s21c1
Sequence:CCGGCAAGACAGCAGATGGTGATTTCTCGAGAAATCACCATCTGCTGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-297s1c1
Sequence:CCGGGAGCAGAATAAGTTGGTGCATCTCGAGATGCACCAACTTATTCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-935s1c1
Sequence:CCGGCTGCAGATACACGAACTGGATCTCGAGATCCAGTTCGTGTATCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-359s1c1
Sequence:CCGGCCTCTACACCTCGGGCCACTTCTCGAGAAGTGGCCCGAGGTGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-590s1c1
Sequence:CCGGAGCCAAACTCTCTGAACTCATCTCGAGATGAGTTCAGAGAGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-798s1c1
Sequence:CCGGGATGAGAAGTACGGGAAGGATCTCGAGATCCTTCCCGTACTTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002774
KLK6 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002774.3-1256s21c1
Sequence:CCGGACCCTTCCACACGTTTGATTTCTCGAGAAATCAAACGTGTGGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002774.3-1077s21c1
Sequence:CCGGCTCTGACCCTGATGCTTAATACTCGAGTATTAAGCATCAGGGTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002774.3-676s21c1
Sequence:CCGGCAAGACAGCAGATGGTGATTTCTCGAGAAATCACCATCTGCTGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-297s1c1
Sequence:CCGGGAGCAGAATAAGTTGGTGCATCTCGAGATGCACCAACTTATTCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-935s1c1
Sequence:CCGGCTGCAGATACACGAACTGGATCTCGAGATCCAGTTCGTGTATCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-359s1c1
Sequence:CCGGCCTCTACACCTCGGGCCACTTCTCGAGAAGTGGCCCGAGGTGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-590s1c1
Sequence:CCGGAGCCAAACTCTCTGAACTCATCTCGAGATGAGTTCAGAGAGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-798s1c1
Sequence:CCGGGATGAGAAGTACGGGAAGGATCTCGAGATCCTTCCCGTACTTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002774
KLK6 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002774.3-1256s21c1
Sequence:CCGGACCCTTCCACACGTTTGATTTCTCGAGAAATCAAACGTGTGGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002774.3-1077s21c1
Sequence:CCGGCTCTGACCCTGATGCTTAATACTCGAGTATTAAGCATCAGGGTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002774.3-676s21c1
Sequence:CCGGCAAGACAGCAGATGGTGATTTCTCGAGAAATCACCATCTGCTGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-297s1c1
Sequence:CCGGGAGCAGAATAAGTTGGTGCATCTCGAGATGCACCAACTTATTCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-935s1c1
Sequence:CCGGCTGCAGATACACGAACTGGATCTCGAGATCCAGTTCGTGTATCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-359s1c1
Sequence:CCGGCCTCTACACCTCGGGCCACTTCTCGAGAAGTGGCCCGAGGTGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-590s1c1
Sequence:CCGGAGCCAAACTCTCTGAACTCATCTCGAGATGAGTTCAGAGAGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002774.2-798s1c1
Sequence:CCGGGATGAGAAGTACGGGAAGGATCTCGAGATCCTTCCCGTACTTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011177
KLK6 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-465s1c1
Sequence:CCGGCCTACGGCAAACAGAGACTTTCTCGAGAAAGTCTCTGTTTGCCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-613s1c1
Sequence:CCGGCCCTTGAAGAATGACTGCTCTCTCGAGAGAGCAGTCATTCTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-791s1c1
Sequence:CCGGACATGAAAGAAGGCAACGATTCTCGAGAATCGTTGCCTTCTTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-289s1c1
Sequence:CCGGGAACAGGAGAAGGTGGTTCATCTCGAGATGAACCACCTTCTCCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-918s1c1
Sequence:CCGGCACCGATGTCTGCACTCATATCTCGAGATATGAGTGCAGACATCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011177
KLK6 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-465s1c1
Sequence:CCGGCCTACGGCAAACAGAGACTTTCTCGAGAAAGTCTCTGTTTGCCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-613s1c1
Sequence:CCGGCCCTTGAAGAATGACTGCTCTCTCGAGAGAGCAGTCATTCTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-791s1c1
Sequence:CCGGACATGAAAGAAGGCAACGATTCTCGAGAATCGTTGCCTTCTTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-289s1c1
Sequence:CCGGGAACAGGAGAAGGTGGTTCATCTCGAGATGAACCACCTTCTCCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-918s1c1
Sequence:CCGGCACCGATGTCTGCACTCATATCTCGAGATATGAGTGCAGACATCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011177
KLK6 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-465s1c1
Sequence:CCGGCCTACGGCAAACAGAGACTTTCTCGAGAAAGTCTCTGTTTGCCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-613s1c1
Sequence:CCGGCCCTTGAAGAATGACTGCTCTCTCGAGAGAGCAGTCATTCTTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-791s1c1
Sequence:CCGGACATGAAAGAAGGCAACGATTCTCGAGAATCGTTGCCTTCTTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-289s1c1
Sequence:CCGGGAACAGGAGAAGGTGGTTCATCTCGAGATGAACCACCTTCTCCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011177.1-918s1c1
Sequence:CCGGCACCGATGTCTGCACTCATATCTCGAGATATGAGTGCAGACATCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)