EMAIL THIS PAGE TO A FRIEND

KLK7

kallikrein-related peptidase 7

106 Gene Product Result for
Synonyms: PRSS6 SCCE hK7
UniProtKB ID: P49862, Q8N5N9, Q8NFV7
Gene ID:
Human(5650) Summary: This gene encodes a member of the kallikrein subfamily of serine proteases. These enzymes have diverse physiological functions and many kallikrein genes are biomarkers for cancer. The encoded protein has chymotrypsin-like activity and plays a role in the proteolysis of intercellular cohesive structures that precedes desquamation, the shedding of the outermost layer of the epidermis. The encoded protein may play a role in cancer invasion and metastasis, and increased expression of this gene is associated with unfavorable prognosis and progression of several types of cancer. Polymorphisms in this gene may play a role in the development of atopic dermatitis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, which is one of fifteen kallikrein subfamily members located in a gene cluster on chromosome 19. [provided by RefSeq, May 2011]
Mouse(23993) kallikrein related-peptidase 7 (chymotryptic, stratum corneum)
Rat(292852) kallikrein-related peptidase 7
chicken(769009) kallikrein-related peptidase 7
cow(506380) kallikrein-related peptidase 7
domestic cat(101088894) kallikrein-related peptidase 7
dog(611780) kallikrein-related peptidase 7
sheep(101115562) kallikrein-related peptidase 7
domestic guinea pig(100716524) kallikrein-related peptidase 7
naked mole-rat(101705516) kallikrein-related peptidase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005046 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088991 MISSION® esiRNA esiRNA human KLK7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005046 Rosetta Predictions human pricing
NM_139277 Rosetta Predictions human pricing
NM_001106254 Rosetta Predictions rat pricing
NM_011872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198996 predicted 412
2 SASI_Hs02_00338845 predicted 339
3 SASI_Hs01_00198997 predicted 464
4 SASI_Hs01_00198998 predicted 732
5 SASI_Hs01_00198999 predicted 521
6 SASI_Hs01_00199000 predicted 573
7 SASI_Hs01_00199001 predicted 409
8 SASI_Hs01_00199002 predicted 410
9 SASI_Hs01_00199003 predicted 624
10 SASI_Hs01_00199004 predicted 411
11 SASI_Hs01_00199005 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079794 predicted 416
2 SASI_Hs01_00079795 predicted 337
3 SASI_Hs01_00079796 predicted 469
4 SASI_Hs01_00079797 predicted 729
5 SASI_Hs01_00079798 predicted 518
6 SASI_Hs01_00079799 predicted 571
7 SASI_Hs01_00079800 predicted 406
8 SASI_Hs01_00079801 predicted 415
9 SASI_Hs01_00079802 predicted 628
10 SASI_Hs01_00079803 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217158 predicted 299
2 SASI_Rn02_00217159 predicted 455
3 SASI_Rn02_00217160 predicted 620
4 SASI_Rn02_00217161 predicted 573
5 SASI_Rn02_00217162 predicted 442
6 SASI_Rn02_00217163 predicted 293
7 SASI_Rn02_00217164 predicted 370
8 SASI_Rn02_00217165 predicted 359
9 SASI_Rn02_00217166 predicted 486
10 SASI_Rn02_00217167 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075411 predicted 428
2 SASI_Mm01_00075412 predicted 849
3 SASI_Mm02_00321659 predicted 306
4 SASI_Mm01_00075413 predicted 419
5 SASI_Mm01_00075414 predicted 389
6 SASI_Mm01_00075415 predicted 946
7 SASI_Mm01_00075417 predicted 885
8 SASI_Mm01_00075418 predicted 249
9 SASI_Mm01_00075419 predicted 338
10 SASI_Mm01_00075420 predicted 663
11 SASI_Mm01_00075416 predicted 645
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011872
KLK7 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-662s1c1
Sequence:CCGGTCTAAGACCAACACGTGCAATCTCGAGATTGCACGTGTTGGTCTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-793s1c1
Sequence:CCGGCAAGTACAAACGGTGGGTGATCTCGAGATCACCCACCGTTTGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-389s1c1
Sequence:CCGGTCCACAAAGACCCACGTCAATCTCGAGATTGACGTGGGTCTTTGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-170s1c1
Sequence:CCGGGATGGCTACAAATGTAAAGAACTCGAGTTCTTTACATTTGTAGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-215s1c1
Sequence:CCGGCTGCTCAAAGGCAATCAGCTTCTCGAGAAGCTGATTGCCTTTGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011872
KLK7 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-662s1c1
Sequence:CCGGTCTAAGACCAACACGTGCAATCTCGAGATTGCACGTGTTGGTCTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-793s1c1
Sequence:CCGGCAAGTACAAACGGTGGGTGATCTCGAGATCACCCACCGTTTGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-389s1c1
Sequence:CCGGTCCACAAAGACCCACGTCAATCTCGAGATTGACGTGGGTCTTTGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-170s1c1
Sequence:CCGGGATGGCTACAAATGTAAAGAACTCGAGTTCTTTACATTTGTAGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-215s1c1
Sequence:CCGGCTGCTCAAAGGCAATCAGCTTCTCGAGAAGCTGATTGCCTTTGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011872
KLK7 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-662s1c1
Sequence:CCGGTCTAAGACCAACACGTGCAATCTCGAGATTGCACGTGTTGGTCTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-793s1c1
Sequence:CCGGCAAGTACAAACGGTGGGTGATCTCGAGATCACCCACCGTTTGTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-389s1c1
Sequence:CCGGTCCACAAAGACCCACGTCAATCTCGAGATTGACGTGGGTCTTTGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-170s1c1
Sequence:CCGGGATGGCTACAAATGTAAAGAACTCGAGTTCTTTACATTTGTAGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011872.2-215s1c1
Sequence:CCGGCTGCTCAAAGGCAATCAGCTTCTCGAGAAGCTGATTGCCTTTGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005046
KLK7 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005046.2-990s1c1
Sequence:CCGGCCCTGTTGATAAACCAATCAACTCGAGTTGATTGGTTTATCAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-828s1c1
Sequence:CCGGCAAGTGGATAAATGACACCATCTCGAGATGGTGTCATTTATCCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-423s1c1
Sequence:CCGGGACCCATGTTAATGACCTCATCTCGAGATGAGGTCATTAACATGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-178s1c1
Sequence:CCGGCAGGGTGACAAGATTATTGATCTCGAGATCAATAATCTTGTCACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-471s1c1
Sequence:CCGGGCTGTCATCCATGGTGAAGAACTCGAGTTCTTCACCATGGATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005046.2-1171s21c1
Sequence:CCGGCTTTGACCCAGTAACTCTAATCTCGAGATTAGAGTTACTGGGTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005046.2-862s21c1
Sequence:CCGGTAACGCCACACTGAGTTAATTCTCGAGAATTAACTCAGTGTGGCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005046.2-925s21c1
Sequence:CCGGCGATGACCTATGAAGTCAAATCTCGAGATTTGACTTCATAGGTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005046
KLK7 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005046.2-990s1c1
Sequence:CCGGCCCTGTTGATAAACCAATCAACTCGAGTTGATTGGTTTATCAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-828s1c1
Sequence:CCGGCAAGTGGATAAATGACACCATCTCGAGATGGTGTCATTTATCCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-423s1c1
Sequence:CCGGGACCCATGTTAATGACCTCATCTCGAGATGAGGTCATTAACATGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-178s1c1
Sequence:CCGGCAGGGTGACAAGATTATTGATCTCGAGATCAATAATCTTGTCACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-471s1c1
Sequence:CCGGGCTGTCATCCATGGTGAAGAACTCGAGTTCTTCACCATGGATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005046.2-1171s21c1
Sequence:CCGGCTTTGACCCAGTAACTCTAATCTCGAGATTAGAGTTACTGGGTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005046.2-862s21c1
Sequence:CCGGTAACGCCACACTGAGTTAATTCTCGAGAATTAACTCAGTGTGGCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005046.2-925s21c1
Sequence:CCGGCGATGACCTATGAAGTCAAATCTCGAGATTTGACTTCATAGGTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005046
KLK7 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005046.2-990s1c1
Sequence:CCGGCCCTGTTGATAAACCAATCAACTCGAGTTGATTGGTTTATCAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-828s1c1
Sequence:CCGGCAAGTGGATAAATGACACCATCTCGAGATGGTGTCATTTATCCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-423s1c1
Sequence:CCGGGACCCATGTTAATGACCTCATCTCGAGATGAGGTCATTAACATGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-178s1c1
Sequence:CCGGCAGGGTGACAAGATTATTGATCTCGAGATCAATAATCTTGTCACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005046.2-471s1c1
Sequence:CCGGGCTGTCATCCATGGTGAAGAACTCGAGTTCTTCACCATGGATGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005046.2-1171s21c1
Sequence:CCGGCTTTGACCCAGTAACTCTAATCTCGAGATTAGAGTTACTGGGTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005046.2-862s21c1
Sequence:CCGGTAACGCCACACTGAGTTAATTCTCGAGAATTAACTCAGTGTGGCGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005046.2-925s21c1
Sequence:CCGGCGATGACCTATGAAGTCAAATCTCGAGATTTGACTTCATAGGTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)