EMAIL THIS PAGE TO A FRIEND

KLK8

kallikrein-related peptidase 8

106 Gene Product Result for
Synonyms: HNP NP NRPN PRSS19 TADG14
Gene ID:
Human(11202) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in four transcript variants encoding four different isoforms. The isoforms exhibit distinct patterns of expression that suggest roles in brain plasticity and ovarian cancer. [provided by RefSeq, Jul 2008]
Mouse(259277) kallikrein related-peptidase 8
Rat(308565) kallikrein related-peptidase 8
domestic guinea pig(100716239) kallikrein-related peptidase 8
naked mole-rat(101715440) kallikrein-related peptidase 8
sheep(101112755) kallikrein-related peptidase 8
domestic cat(101090308) kallikrein-related peptidase 8
cow(618438) kallikrein-related peptidase 8
dog(484352) kallikrein-related peptidase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008940 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008940 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008940 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007196 Rosetta Predictions human pricing
NM_144505 Rosetta Predictions human pricing
NM_144506 Rosetta Predictions human pricing
NM_144507 Rosetta Predictions human pricing
NM_001107509 Rosetta Predictions rat pricing
NM_008940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162846 predicted 589
2 SASI_Hs01_00162847 predicted 586
3 SASI_Hs01_00162848 predicted 689
4 SASI_Hs01_00162849 predicted 682
5 SASI_Hs01_00162850 predicted 784
6 SASI_Hs01_00162851 predicted 590
7 SASI_Hs01_00162852 predicted 462
8 SASI_Hs01_00162853 predicted 521
9 SASI_Hs01_00162854 predicted 683
10 SASI_Hs01_00162855 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199834 predicted 717
2 SASI_Hs01_00199835 predicted 723
3 SASI_Hs01_00199836 predicted 824
4 SASI_Hs01_00199837 predicted 813
5 SASI_Hs01_00199838 predicted 924
6 SASI_Hs01_00199839 predicted 723
7 SASI_Hs01_00199840 predicted 594
8 SASI_Hs01_00199841 predicted 659
9 SASI_Hs01_00199842 predicted 809
10 SASI_Hs01_00199843 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076249 predicted 264
2 SASI_Hs01_00076250 predicted 253
3 SASI_Hs01_00076251 predicted 365
4 SASI_Hs01_00076254 predicted 259
5 SASI_Hs01_00076255 predicted 261
6 SASI_Hs01_00076256 predicted 371
7 SASI_Hs01_00076257 predicted 292
8 SASI_Hs01_00076258 predicted 553
9 SASI_Hs02_00364324 predicted 458
10 SASI_Hs02_00364325 predicted 528
11 SASI_Hs01_00076252 predicted 267
12 SASI_Hs01_00076253 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230829 predicted 416
2 SASI_Hs01_00230830 predicted 391
3 SASI_Hs02_00364326 predicted 328
4 SASI_Hs01_00230832 predicted 394
5 SASI_Hs01_00230833 predicted 320
6 SASI_Hs02_00364327 predicted 398
7 SASI_Hs01_00230834 predicted 337
8 SASI_Hs02_00364328 predicted 324
9 SASI_Hs01_00230835 predicted 407
10 SASI_Hs01_00230838 predicted 423
11 SASI_Hs01_00230831 predicted 396
12 SASI_Hs01_00230836 predicted 398
13 SASI_Hs01_00230837 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229525 predicted 841
2 SASI_Rn02_00229526 predicted 601
3 SASI_Rn02_00229527 predicted 772
4 SASI_Rn02_00229528 predicted 1050
5 SASI_Rn02_00229529 predicted 961
6 SASI_Rn02_00229530 predicted 578
7 SASI_Rn02_00229531 predicted 748
8 SASI_Rn02_00229532 predicted 826
9 SASI_Rn02_00229533 predicted 887
10 SASI_Rn02_00229534 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197063 predicted 511
2 SASI_Mm01_00197064 predicted 894
3 SASI_Mm01_00197065 predicted 836
4 SASI_Mm01_00197066 predicted 824
5 SASI_Mm01_00197067 predicted 911
6 SASI_Mm01_00197068 predicted 988
7 SASI_Mm02_00314979 predicted 836
8 SASI_Mm01_00197069 predicted 965
9 SASI_Mm01_00197070 predicted 716
10 SASI_Mm02_00314980 predicted 784
11 SASI_Mm01_00197071 predicted 770
12 SASI_Mm01_00197072 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007196
KLK8 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007196.2-367s21c1
Sequence:CCGGTAGGTGGCAACTGGGTCCTTACTCGAGTAAGGACCCAGTTGCCACCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007196.2-592s21c1
Sequence:CCGGCCATCAGCCTGGCAGATCATTCTCGAGAATGATCTGCCAGGCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007196.2-429s21c1
Sequence:CCGGGGAGACCACAGCCTACAGAATCTCGAGATTCTGTAGGCTGTGGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-534s1c1
Sequence:CCGGCATGATCTGATGCTTCTTCAACTCGAGTTGAAGAAGCATCAGATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-688s1c1
Sequence:CCGGCTCTCAACTGTGCAGAAGTAACTCGAGTTACTTCTGCACAGTTGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-324s1c1
Sequence:CCGGGCCTTGTTCCAGGGCCAGCAACTCGAGTTGCTGGCCCTGGAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-209s1c1
Sequence:CCGGGACGTGGATGTTCCTGCTCTTCTCGAGAAGAGCAGGAACATCCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-464s1c1
Sequence:CCGGGCAAGAAATACCTGTGGTTCACTCGAGTGAACCACAGGTATTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007196
KLK8 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007196.2-367s21c1
Sequence:CCGGTAGGTGGCAACTGGGTCCTTACTCGAGTAAGGACCCAGTTGCCACCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007196.2-592s21c1
Sequence:CCGGCCATCAGCCTGGCAGATCATTCTCGAGAATGATCTGCCAGGCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007196.2-429s21c1
Sequence:CCGGGGAGACCACAGCCTACAGAATCTCGAGATTCTGTAGGCTGTGGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-534s1c1
Sequence:CCGGCATGATCTGATGCTTCTTCAACTCGAGTTGAAGAAGCATCAGATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-688s1c1
Sequence:CCGGCTCTCAACTGTGCAGAAGTAACTCGAGTTACTTCTGCACAGTTGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-324s1c1
Sequence:CCGGGCCTTGTTCCAGGGCCAGCAACTCGAGTTGCTGGCCCTGGAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-209s1c1
Sequence:CCGGGACGTGGATGTTCCTGCTCTTCTCGAGAAGAGCAGGAACATCCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-464s1c1
Sequence:CCGGGCAAGAAATACCTGTGGTTCACTCGAGTGAACCACAGGTATTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007196
KLK8 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007196.2-367s21c1
Sequence:CCGGTAGGTGGCAACTGGGTCCTTACTCGAGTAAGGACCCAGTTGCCACCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007196.2-592s21c1
Sequence:CCGGCCATCAGCCTGGCAGATCATTCTCGAGAATGATCTGCCAGGCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007196.2-429s21c1
Sequence:CCGGGGAGACCACAGCCTACAGAATCTCGAGATTCTGTAGGCTGTGGTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-534s1c1
Sequence:CCGGCATGATCTGATGCTTCTTCAACTCGAGTTGAAGAAGCATCAGATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-688s1c1
Sequence:CCGGCTCTCAACTGTGCAGAAGTAACTCGAGTTACTTCTGCACAGTTGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-324s1c1
Sequence:CCGGGCCTTGTTCCAGGGCCAGCAACTCGAGTTGCTGGCCCTGGAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-209s1c1
Sequence:CCGGGACGTGGATGTTCCTGCTCTTCTCGAGAAGAGCAGGAACATCCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007196.2-464s1c1
Sequence:CCGGGCAAGAAATACCTGTGGTTCACTCGAGTGAACCACAGGTATTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008940
KLK8 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-972s1c1
Sequence:CCGGCCCTCAAGAGAACTTTCCAAACTCGAGTTTGGAAAGTTCTCTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-837s1c1
Sequence:CCGGCAGTCACGATATAATGCTCATCTCGAGATGAGCATTATATCGTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-996s1c1
Sequence:CCGGCCTCAACTGTGCGGAAGTGAACTCGAGTTCACTTCCGCACAGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-826s1c1
Sequence:CCGGCCAGAAGATCACAGTCACGATCTCGAGATCGTGACTGTGATCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-798s1c1
Sequence:CCGGCCAGCATCCTTGCTACAACAACTCGAGTTGTTGTAGCAAGGATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008940
KLK8 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-972s1c1
Sequence:CCGGCCCTCAAGAGAACTTTCCAAACTCGAGTTTGGAAAGTTCTCTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-837s1c1
Sequence:CCGGCAGTCACGATATAATGCTCATCTCGAGATGAGCATTATATCGTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-996s1c1
Sequence:CCGGCCTCAACTGTGCGGAAGTGAACTCGAGTTCACTTCCGCACAGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-826s1c1
Sequence:CCGGCCAGAAGATCACAGTCACGATCTCGAGATCGTGACTGTGATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-798s1c1
Sequence:CCGGCCAGCATCCTTGCTACAACAACTCGAGTTGTTGTAGCAAGGATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008940
KLK8 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-972s1c1
Sequence:CCGGCCCTCAAGAGAACTTTCCAAACTCGAGTTTGGAAAGTTCTCTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-837s1c1
Sequence:CCGGCAGTCACGATATAATGCTCATCTCGAGATGAGCATTATATCGTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-996s1c1
Sequence:CCGGCCTCAACTGTGCGGAAGTGAACTCGAGTTCACTTCCGCACAGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-826s1c1
Sequence:CCGGCCAGAAGATCACAGTCACGATCTCGAGATCGTGACTGTGATCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008940.1-798s1c1
Sequence:CCGGCCAGCATCCTTGCTACAACAACTCGAGTTGTTGTAGCAAGGATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)