EMAIL THIS PAGE TO A FRIEND

KLK9

kallikrein-related peptidase 9

53 Gene Product Result for
Synonyms: KLK-L3 KLKL3
UniProtKB ID: Q9UKQ9
Gene ID:
Human(284366) Summary: The protein encoded by this gene is a kallikrein-related serine protease. This gene is activated by steroid hormones in a human breast cancer cell line, making it a good marker for cancer detection. The encoded protein is found primarily in the cytoplasm.[provided by RefSeq, Oct 2010]
Mouse(101533) kallikrein related-peptidase 9
Rat(292851) kallikrein related-peptidase 9
cow(530795) kallikrein-related peptidase 9
domestic cat(101097689) kallikrein-related peptidase 9
dog(100329125) kallikrein-related peptidase 9
sheep(101114298) kallikrein-related peptidase 9
domestic guinea pig(100715957) kallikrein-related peptidase 9
naked mole-rat(101714490) kallikrein-related peptidase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012315 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012315 Rosetta Predictions human pricing
NM_001106253 Rosetta Predictions rat pricing
NM_028660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133780 predicted 1059
2 SASI_Hs01_00133781 predicted 783
3 SASI_Hs01_00133783 predicted 1052
4 SASI_Hs01_00133784 predicted 1051
5 SASI_Hs01_00133785 predicted 1052
6 SASI_Hs01_00133786 predicted 599
7 SASI_Hs01_00133787 predicted 1089
8 SASI_Hs01_00133788 predicted 676
9 SASI_Hs01_00133789 predicted 504
10 SASI_Hs02_00344086 predicted 794
11 SASI_Hs01_00133782 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217148 predicted 805
2 SASI_Rn02_00217149 predicted 476
3 SASI_Rn02_00217150 predicted 218
4 SASI_Rn02_00217151 predicted 340
5 SASI_Rn02_00217152 predicted 793
6 SASI_Rn02_00217153 predicted 790
7 SASI_Rn02_00217154 predicted 321
8 SASI_Rn02_00217155 predicted 378
9 SASI_Rn02_00217156 predicted 788
10 SASI_Rn02_00217157 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334187 predicted 884
2 SASI_Mm02_00334188 predicted 858
3 SASI_Mm02_00334189 predicted 591
4 SASI_Mm01_00066200 predicted 407
5 SASI_Mm02_00334190 predicted 646
6 SASI_Mm01_00066203 predicted 734
7 SASI_Mm02_00334191 predicted 799
8 SASI_Mm02_00334192 predicted 798
9 SASI_Mm02_00334193 predicted 554
10 SASI_Mm02_00334194 predicted 389
11 SASI_Mm01_00066197 predicted 573
12 SASI_Mm01_00066198 predicted 493
13 SASI_Mm01_00066199 predicted 483
14 SASI_Mm01_00066201 predicted 630
15 SASI_Mm01_00066202 predicted 363
16 SASI_Mm01_00066204 predicted 728
17 SASI_Mm01_00066205 predicted 682
18 SASI_Mm01_00066206 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028660
KLK9 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028660.3-1249s21c1
Sequence:CCGGTGCTGCAACCCTTCATATTTCCTCGAGGAAATATGAAGGGTTGCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028660.3-801s21c1
Sequence:CCGGCTGTCTACACTAACGTCTTTGCTCGAGCAAAGACGTTAGTGTAGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028660.3-423s21c1
Sequence:CCGGATGACCACAATGATGATATTACTCGAGTAATATCATCATTGTGGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-495s1c1
Sequence:CCGGGCTCCAAATTACAGTATCCAACTCGAGTTGGATACTGTAATTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-483s1c1
Sequence:CCGGGCAGTGTGTCAAGCTCCAAATCTCGAGATTTGGAGCTTGACACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-729s1c1
Sequence:CCGGCCGCTGTTTACACTAACGTTTCTCGAGAAACGTTAGTGTAAACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-185s1c1
Sequence:CCGGGCCACGCTCATCAATGATCAACTCGAGTTGATCATTGATGAGCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028660.3-1181s21c1
Sequence:CCGGTAATCACCATTCTCTGGAATACTCGAGTATTCCAGAGAATGGTGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028660
KLK9 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028660.3-1249s21c1
Sequence:CCGGTGCTGCAACCCTTCATATTTCCTCGAGGAAATATGAAGGGTTGCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028660.3-801s21c1
Sequence:CCGGCTGTCTACACTAACGTCTTTGCTCGAGCAAAGACGTTAGTGTAGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028660.3-423s21c1
Sequence:CCGGATGACCACAATGATGATATTACTCGAGTAATATCATCATTGTGGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-495s1c1
Sequence:CCGGGCTCCAAATTACAGTATCCAACTCGAGTTGGATACTGTAATTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-483s1c1
Sequence:CCGGGCAGTGTGTCAAGCTCCAAATCTCGAGATTTGGAGCTTGACACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-729s1c1
Sequence:CCGGCCGCTGTTTACACTAACGTTTCTCGAGAAACGTTAGTGTAAACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-185s1c1
Sequence:CCGGGCCACGCTCATCAATGATCAACTCGAGTTGATCATTGATGAGCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028660.3-1181s21c1
Sequence:CCGGTAATCACCATTCTCTGGAATACTCGAGTATTCCAGAGAATGGTGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028660
KLK9 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028660.3-1249s21c1
Sequence:CCGGTGCTGCAACCCTTCATATTTCCTCGAGGAAATATGAAGGGTTGCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028660.3-801s21c1
Sequence:CCGGCTGTCTACACTAACGTCTTTGCTCGAGCAAAGACGTTAGTGTAGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028660.3-423s21c1
Sequence:CCGGATGACCACAATGATGATATTACTCGAGTAATATCATCATTGTGGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-495s1c1
Sequence:CCGGGCTCCAAATTACAGTATCCAACTCGAGTTGGATACTGTAATTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-483s1c1
Sequence:CCGGGCAGTGTGTCAAGCTCCAAATCTCGAGATTTGGAGCTTGACACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-729s1c1
Sequence:CCGGCCGCTGTTTACACTAACGTTTCTCGAGAAACGTTAGTGTAAACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028660.1-185s1c1
Sequence:CCGGGCCACGCTCATCAATGATCAACTCGAGTTGATCATTGATGAGCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028660.3-1181s21c1
Sequence:CCGGTAATCACCATTCTCTGGAATACTCGAGTATTCCAGAGAATGGTGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012315
KLK9 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012315.1-308s21c1
Sequence:CCGGGAGAGCACCACCTCTGGAAATCTCGAGATTTCCAGAGGTGGTGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-779s1c1
Sequence:CCGGCCGCAGTCTACACCAGCGTATCTCGAGATACGCTGGTGTAGACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-348s1c1
Sequence:CCGGGTTCCGGGTTACGGACTTCTTCTCGAGAAGAAGTCCGTAACCCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-615s1c1
Sequence:CCGGCTGGGCATACCCTGGACACATCTCGAGATGTGTCCAGGGTATGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-810s1c1
Sequence:CCGGTGACTGGATCCAAGAAATCATCTCGAGATGATTTCTTGGATCCAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-207s1c1
Sequence:CCGGCTTCCACCTTACTCGGCTCTTCTCGAGAAGAGCCGAGTAAGGTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012315.1-395s21c1
Sequence:CCGGTCAGCGCCAATGACCACAATGCTCGAGCATTGTGGTCATTGGCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012315.1-587s21c1
Sequence:CCGGTCAGCATCCTGGAGAACAAACCTCGAGGTTTGTTCTCCAGGATGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012315
KLK9 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012315.1-308s21c1
Sequence:CCGGGAGAGCACCACCTCTGGAAATCTCGAGATTTCCAGAGGTGGTGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-779s1c1
Sequence:CCGGCCGCAGTCTACACCAGCGTATCTCGAGATACGCTGGTGTAGACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-348s1c1
Sequence:CCGGGTTCCGGGTTACGGACTTCTTCTCGAGAAGAAGTCCGTAACCCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-615s1c1
Sequence:CCGGCTGGGCATACCCTGGACACATCTCGAGATGTGTCCAGGGTATGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-810s1c1
Sequence:CCGGTGACTGGATCCAAGAAATCATCTCGAGATGATTTCTTGGATCCAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-207s1c1
Sequence:CCGGCTTCCACCTTACTCGGCTCTTCTCGAGAAGAGCCGAGTAAGGTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012315.1-395s21c1
Sequence:CCGGTCAGCGCCAATGACCACAATGCTCGAGCATTGTGGTCATTGGCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012315.1-587s21c1
Sequence:CCGGTCAGCATCCTGGAGAACAAACCTCGAGGTTTGTTCTCCAGGATGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012315
KLK9 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012315.1-308s21c1
Sequence:CCGGGAGAGCACCACCTCTGGAAATCTCGAGATTTCCAGAGGTGGTGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-779s1c1
Sequence:CCGGCCGCAGTCTACACCAGCGTATCTCGAGATACGCTGGTGTAGACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-348s1c1
Sequence:CCGGGTTCCGGGTTACGGACTTCTTCTCGAGAAGAAGTCCGTAACCCGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-615s1c1
Sequence:CCGGCTGGGCATACCCTGGACACATCTCGAGATGTGTCCAGGGTATGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-810s1c1
Sequence:CCGGTGACTGGATCCAAGAAATCATCTCGAGATGATTTCTTGGATCCAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012315.1-207s1c1
Sequence:CCGGCTTCCACCTTACTCGGCTCTTCTCGAGAAGAGCCGAGTAAGGTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012315.1-395s21c1
Sequence:CCGGTCAGCGCCAATGACCACAATGCTCGAGCATTGTGGTCATTGGCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012315.1-587s21c1
Sequence:CCGGTCAGCATCCTGGAGAACAAACCTCGAGGTTTGTTCTCCAGGATGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)