EMAIL THIS PAGE TO A FRIEND

KLKB1

kallikrein B, plasma (Fletcher factor) 1

88 Gene Product Result for
Synonyms: KLK3 PPK
UniProtKB ID: P03952, A6NH96, B2R8H9, Q17RE8, Q17RE9, Q4W5C3
Gene ID:
Human(3818) Summary: Plasma prekallikrein is a glycoprotein that participates in the surface-dependent activation of blood coagulation, fibrinolysis, kinin generation and inflammation. It is synthesized in the liver and secreted into the blood as a single polypeptide chain. Plasma prekallikrein is converted to plasma kallikrein by factor XIIa by the cleavage of an internal Arg-Ile bond. Plasma kallikrein therefore is composed of a heavy chain and a light chain held together by a disulphide bond. The heavy chain originates from the amino-terminal end of the zymogen and contains 4 tandem repeats of 90 or 91 amino acids. Each repeat harbors a novel structure called the apple domain. The heavy chain is required for the surface-dependent pro-coagulant activity of plasma kallikrein. The light chain contains the active site or catalytic domain of the enzyme and is homologous to the trypsin family of serine proteases. Plasma prekallikrein deficiency causes a prolonged activated partial thromboplastin time in patients. [provided by RefSeq, Jul 2008]
Mouse(16621) kallikrein B, plasma 1
Rat(25048) kallikrein B, plasma 1
domestic guinea pig(100715794) kallikrein B, plasma (Fletcher factor) 1
naked mole-rat(101719264) kallikrein B, plasma (Fletcher factor) 1
sheep(101116376) kallikrein B, plasma (Fletcher factor) 1
Domestic Rabbit(100356267) kallikrein B, plasma (Fletcher factor) 1
cow(533547) kallikrein B, plasma (Fletcher factor) 1
Horse(100056650) kallikrein B, plasma (Fletcher factor) 1
dog(475624) kallikrein B, plasma (Fletcher factor) 1
domestic cat(101094092) kallikrein B, plasma (Fletcher factor) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0538 AQUA Peptide EIIIHQNY[K] human pricing
AQ0539 AQUA Peptide GEIQNILQ[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049271 MISSION® esiRNA esiRNA human KLKB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000892 Rosetta Predictions human pricing
NM_012725 Rosetta Predictions rat pricing
NM_008455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303445 predicted 1391
2 SASI_Hs01_00106759 predicted 593
3 SASI_Hs01_00106760 predicted 230
4 SASI_Hs02_00303446 predicted 257
5 SASI_Hs01_00106762 predicted 1590
6 SASI_Hs01_00106763 predicted 423
7 SASI_Hs01_00106764 predicted 1038
8 SASI_Hs02_00303447 predicted 1093
9 SASI_Hs01_00106765 predicted 659
10 SASI_Hs02_00303448 predicted 487
11 SASI_Hs01_00106756 predicted 1685
12 SASI_Hs01_00106757 predicted 819
13 SASI_Hs01_00106758 predicted 1097
14 SASI_Hs01_00106761 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260069 predicted 1898
2 SASI_Rn01_00042977 predicted 790
3 SASI_Rn01_00042978 predicted 1890
4 SASI_Rn01_00042979 predicted 1242
5 SASI_Rn01_00042981 predicted 263
6 SASI_Rn01_00042982 predicted 1754
7 SASI_Rn01_00042980 predicted 196
8 SASI_Rn01_00042984 predicted 1161
9 SASI_Rn01_00042985 predicted 1028
10 SASI_Rn01_00042986 predicted 417
11 SASI_Rn01_00042983 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096511 predicted 1567
2 SASI_Mm02_00313958 predicted 2442
3 SASI_Mm01_00096512 predicted 968
4 SASI_Mm01_00096513 predicted 1919
5 SASI_Mm01_00096514 predicted 1949
6 SASI_Mm01_00096515 predicted 2177
7 SASI_Mm01_00096516 predicted 1008
8 SASI_Mm02_00313959 predicted 1343
9 SASI_Mm01_00096517 predicted 1054
10 SASI_Mm01_00096519 predicted 985
11 SASI_Mm01_00096518 predicted 946
12 SASI_Mm01_00096520 predicted 1348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000892
KLKB1 MISSION shRNA Bacterial Glycerol Stock
kallikrein B, plasma (Fletcher factor) 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000892.3-2018s21c1
Sequence:CCGGCAACCTGAGTTCAAGTCAAATCTCGAGATTTGACTTGAACTCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-397s21c1
Sequence:CCGGGTGCTTGCCATCGAGACATTTCTCGAGAAATGTCTCGATGGCAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-1450s21c1
Sequence:CCGGATACACCTTTCTCACAAATAACTCGAGTTATTTGTGAGAAAGGTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-556s21c1
Sequence:CCGGACCGGAACAATTGCCTATTAACTCGAGTTAATAGGCAATTGTTCCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-1396s21c1
Sequence:CCGGAGGATGTTTGGCGCATCTATACTCGAGTATAGATGCGCCAAACATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-301s1c1
Sequence:CCGGGCTTCTTGAAAGATAGTGTTACTCGAGTAACACTATCTTTCAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-1914s1c1
Sequence:CCGGGCTGAGTACATGGACTGGATTCTCGAGAATCCAGTCCATGTACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-601s1c1
Sequence:CCGGCCGCTATAAAGGTGCTGAGTACTCGAGTACTCAGCACCTTTATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-781s1c1
Sequence:CCGGGCCTCTTCTTTACATTCTATACTCGAGTATAGAATGTAAAGAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-466s1c1
Sequence:CCGGGCAGTGTTGAAGAATGCCAAACTCGAGTTTGGCATTCTTCAACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000892
KLKB1 MISSION shRNA shRNA Plasmid DNA
kallikrein B, plasma (Fletcher factor) 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000892.3-2018s21c1
Sequence:CCGGCAACCTGAGTTCAAGTCAAATCTCGAGATTTGACTTGAACTCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-397s21c1
Sequence:CCGGGTGCTTGCCATCGAGACATTTCTCGAGAAATGTCTCGATGGCAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-1450s21c1
Sequence:CCGGATACACCTTTCTCACAAATAACTCGAGTTATTTGTGAGAAAGGTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-556s21c1
Sequence:CCGGACCGGAACAATTGCCTATTAACTCGAGTTAATAGGCAATTGTTCCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-1396s21c1
Sequence:CCGGAGGATGTTTGGCGCATCTATACTCGAGTATAGATGCGCCAAACATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-301s1c1
Sequence:CCGGGCTTCTTGAAAGATAGTGTTACTCGAGTAACACTATCTTTCAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-1914s1c1
Sequence:CCGGGCTGAGTACATGGACTGGATTCTCGAGAATCCAGTCCATGTACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-601s1c1
Sequence:CCGGCCGCTATAAAGGTGCTGAGTACTCGAGTACTCAGCACCTTTATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-781s1c1
Sequence:CCGGGCCTCTTCTTTACATTCTATACTCGAGTATAGAATGTAAAGAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-466s1c1
Sequence:CCGGGCAGTGTTGAAGAATGCCAAACTCGAGTTTGGCATTCTTCAACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000892
KLKB1 MISSION shRNA Lentiviral Transduction Particles
kallikrein B, plasma (Fletcher factor) 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000892.3-2018s21c1
Sequence:CCGGCAACCTGAGTTCAAGTCAAATCTCGAGATTTGACTTGAACTCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-397s21c1
Sequence:CCGGGTGCTTGCCATCGAGACATTTCTCGAGAAATGTCTCGATGGCAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-1450s21c1
Sequence:CCGGATACACCTTTCTCACAAATAACTCGAGTTATTTGTGAGAAAGGTGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-556s21c1
Sequence:CCGGACCGGAACAATTGCCTATTAACTCGAGTTAATAGGCAATTGTTCCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000892.3-1396s21c1
Sequence:CCGGAGGATGTTTGGCGCATCTATACTCGAGTATAGATGCGCCAAACATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-301s1c1
Sequence:CCGGGCTTCTTGAAAGATAGTGTTACTCGAGTAACACTATCTTTCAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-1914s1c1
Sequence:CCGGGCTGAGTACATGGACTGGATTCTCGAGAATCCAGTCCATGTACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-601s1c1
Sequence:CCGGCCGCTATAAAGGTGCTGAGTACTCGAGTACTCAGCACCTTTATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-781s1c1
Sequence:CCGGGCCTCTTCTTTACATTCTATACTCGAGTATAGAATGTAAAGAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000892.2-466s1c1
Sequence:CCGGGCAGTGTTGAAGAATGCCAAACTCGAGTTTGGCATTCTTCAACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008455
KLKB1 MISSION shRNA Bacterial Glycerol Stock
kallikrein B, plasma (Fletcher factor) 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-1996s1c1
Sequence:CCGGCGAGAATAAAGGAGCTTATTACTCGAGTAATAAGCTCCTTTATTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-2438s1c1
Sequence:CCGGCACCAAAGTTTCTGAGTACATCTCGAGATGTACTCAGAAACTTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-804s1c1
Sequence:CCGGCCACCCAAAGAGACAAATAAACTCGAGTTTATTTGTCTCTTTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-1705s1c1
Sequence:CCGGGCTCCGGTTATTCTCTGAGATCTCGAGATCTCAGAGAATAACCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-942s1c1
Sequence:CCGGCGAGACATATACAAAGGACTTCTCGAGAAGTCCTTTGTATATGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008455
KLKB1 MISSION shRNA shRNA Plasmid DNA
kallikrein B, plasma (Fletcher factor) 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-1996s1c1
Sequence:CCGGCGAGAATAAAGGAGCTTATTACTCGAGTAATAAGCTCCTTTATTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-2438s1c1
Sequence:CCGGCACCAAAGTTTCTGAGTACATCTCGAGATGTACTCAGAAACTTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-804s1c1
Sequence:CCGGCCACCCAAAGAGACAAATAAACTCGAGTTTATTTGTCTCTTTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-1705s1c1
Sequence:CCGGGCTCCGGTTATTCTCTGAGATCTCGAGATCTCAGAGAATAACCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-942s1c1
Sequence:CCGGCGAGACATATACAAAGGACTTCTCGAGAAGTCCTTTGTATATGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008455
KLKB1 MISSION shRNA Lentiviral Transduction Particles
kallikrein B, plasma (Fletcher factor) 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-1996s1c1
Sequence:CCGGCGAGAATAAAGGAGCTTATTACTCGAGTAATAAGCTCCTTTATTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-2438s1c1
Sequence:CCGGCACCAAAGTTTCTGAGTACATCTCGAGATGTACTCAGAAACTTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-804s1c1
Sequence:CCGGCCACCCAAAGAGACAAATAAACTCGAGTTTATTTGTCTCTTTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-1705s1c1
Sequence:CCGGGCTCCGGTTATTCTCTGAGATCTCGAGATCTCAGAGAATAACCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008455.1-942s1c1
Sequence:CCGGCGAGACATATACAAAGGACTTCTCGAGAAGTCCTTTGTATATGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)