EMAIL THIS PAGE TO A FRIEND

KLLN

killin, p53-regulated DNA replication inhibitor

17 Gene Product Result for
Synonyms: CWS4 KILLIN
UniProtKB ID: B2CW77
Gene ID:
Human(100144748) Summary: The protein encoded by this intronless gene is found in the nucleus, where it can inhibit DNA synthesis and promote S phase arrest coupled to apoptosis. The expression of this DNA binding protein is upregulated by transcription factor p53. [provided by RefSeq, Dec 2012]
domestic cat(101098164) killin, p53-regulated DNA replication inhibitor
sheep(101122485) killin, p53-regulated DNA replication inhibitor
naked mole-rat(101701901) killin, p53-regulated DNA replication inhibitor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001126049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001126049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001126049 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126049 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327997 predicted 1903
2 SASI_Hs02_00327998 predicted 1785
3 SASI_Hs02_00327999 predicted 1758
4 SASI_Hs02_00328000 predicted 1480
5 SASI_Hs02_00328001 predicted 1118
6 SASI_Hs02_00328002 predicted 1777
7 SASI_Hs02_00328003 predicted 1860
8 SASI_Hs02_00328004 predicted 1939
9 SASI_Hs02_00328005 predicted 1735
10 SASI_Hs02_00328006 predicted 1833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126049
KLLN MISSION shRNA Bacterial Glycerol Stock
killin, p53-regulated DNA replication inhibitor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1204s21c1
Sequence:CCGGGCAAGTCGTCTTCTTCCTTTGCTCGAGCAAAGGAAGAAGACGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1008s21c1
Sequence:CCGGTACCGGGTTGAGTGGAAAGTACTCGAGTACTTTCCACTCAACCCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1113s21c1
Sequence:CCGGGCCACAGTCGGAACTACTTTCCTCGAGGAAAGTAGTTCCGACTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1071s21c1
Sequence:CCGGGGAGACCTAGGAGGGTTCAAACTCGAGTTTGAACCCTCCTAGGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126049.1-1914s21c1
Sequence:CCGGCAAGTAGTCGACCCGCTTAAACTCGAGTTTAAGCGGGTCGACTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126049
KLLN MISSION shRNA shRNA Plasmid DNA
killin, p53-regulated DNA replication inhibitor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1204s21c1
Sequence:CCGGGCAAGTCGTCTTCTTCCTTTGCTCGAGCAAAGGAAGAAGACGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1008s21c1
Sequence:CCGGTACCGGGTTGAGTGGAAAGTACTCGAGTACTTTCCACTCAACCCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1113s21c1
Sequence:CCGGGCCACAGTCGGAACTACTTTCCTCGAGGAAAGTAGTTCCGACTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1071s21c1
Sequence:CCGGGGAGACCTAGGAGGGTTCAAACTCGAGTTTGAACCCTCCTAGGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126049.1-1914s21c1
Sequence:CCGGCAAGTAGTCGACCCGCTTAAACTCGAGTTTAAGCGGGTCGACTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126049
KLLN MISSION shRNA Lentiviral Transduction Particles
killin, p53-regulated DNA replication inhibitor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1204s21c1
Sequence:CCGGGCAAGTCGTCTTCTTCCTTTGCTCGAGCAAAGGAAGAAGACGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1008s21c1
Sequence:CCGGTACCGGGTTGAGTGGAAAGTACTCGAGTACTTTCCACTCAACCCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1113s21c1
Sequence:CCGGGCCACAGTCGGAACTACTTTCCTCGAGGAAAGTAGTTCCGACTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126049.1-1071s21c1
Sequence:CCGGGGAGACCTAGGAGGGTTCAAACTCGAGTTTGAACCCTCCTAGGTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126049.1-1914s21c1
Sequence:CCGGCAAGTAGTCGACCCGCTTAAACTCGAGTTTAAGCGGGTCGACTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)