EMAIL THIS PAGE TO A FRIEND

KLRAP1

killer cell lectin-like receptor subfamily A pseudogene 1

47 Gene Product Result for
Synonyms: KLRA# KLRA1 LY49L Ly-49L Ly49
Species: Human KLRAP1(10748), domestic cat KLRAP1(493746)
Gene ID:
domestic cat(493746) killer cell lectin-like receptor subfamily A pseudogene 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006611 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078331 MISSION® esiRNA esiRNA human KLRA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006611 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214348 predicted 897
2 SASI_Hs01_00214349 predicted 1039
3 SASI_Hs02_00341942 predicted 983
4 SASI_Hs01_00214351 predicted 734
5 SASI_Hs02_00341943 predicted 598
6 SASI_Hs02_00341944 predicted 604
7 SASI_Hs01_00214356 predicted 930
8 SASI_Hs02_00341945 predicted 1067
9 SASI_Hs02_00341946 predicted 552
10 SASI_Hs02_00341947 predicted 892
11 SASI_Hs01_00214350 predicted 800
12 SASI_Hs01_00214352 predicted 935
13 SASI_Hs01_00214353 predicted 624
14 SASI_Hs01_00214354 predicted 872
15 SASI_Hs01_00214355 predicted 861
16 SASI_Hs01_00214357 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006611
KLRAP1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily A pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-629s1c1
Sequence:CCGGCTTGTCAACATTGTAGATCATCTCGAGATGATCTACAATGTTGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-460s1c1
Sequence:CCGGGAACTGGATTCACGCCTTATACTCGAGTATAAGGCGTGAATCCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-667s1c1
Sequence:CCGGGACAAAGATGAACTCGTATTTCTCGAGAAATACGAGTTCATCTTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-157s1c1
Sequence:CCGGCAGAATAGATTAAGGCCTGATCTCGAGATCAGGCCTTAATCTATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-563s1c1
Sequence:CCGGCCTGTTGTGGAGTAAACTGTTCTCGAGAACAGTTTACTCCACAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006611
KLRAP1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily A pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-629s1c1
Sequence:CCGGCTTGTCAACATTGTAGATCATCTCGAGATGATCTACAATGTTGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-460s1c1
Sequence:CCGGGAACTGGATTCACGCCTTATACTCGAGTATAAGGCGTGAATCCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-667s1c1
Sequence:CCGGGACAAAGATGAACTCGTATTTCTCGAGAAATACGAGTTCATCTTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-157s1c1
Sequence:CCGGCAGAATAGATTAAGGCCTGATCTCGAGATCAGGCCTTAATCTATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-563s1c1
Sequence:CCGGCCTGTTGTGGAGTAAACTGTTCTCGAGAACAGTTTACTCCACAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006611
KLRAP1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily A pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-629s1c1
Sequence:CCGGCTTGTCAACATTGTAGATCATCTCGAGATGATCTACAATGTTGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-460s1c1
Sequence:CCGGGAACTGGATTCACGCCTTATACTCGAGTATAAGGCGTGAATCCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-667s1c1
Sequence:CCGGGACAAAGATGAACTCGTATTTCTCGAGAAATACGAGTTCATCTTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-157s1c1
Sequence:CCGGCAGAATAGATTAAGGCCTGATCTCGAGATCAGGCCTTAATCTATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006611.1-563s1c1
Sequence:CCGGCCTGTTGTGGAGTAAACTGTTCTCGAGAACAGTTTACTCCACAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)