EMAIL THIS PAGE TO A FRIEND

KLRB1

killer cell lectin-like receptor subfamily B, member 1

46 Gene Product Result for
Synonyms: CD161 CLEC5B NKR NKR-P1 NKR-P1A NKRP1A hNKR-P1A
UniProtKB ID: Q12918, Q24K24
Gene ID:
Human(3820) Summary: Natural killer (NK) cells are lymphocytes that mediate cytotoxicity and secrete cytokines after immune stimulation. Several genes of the C-type lectin superfamily, including the rodent NKRP1 family of glycoproteins, are expressed by NK cells and may be involved in the regulation of NK cell function. The KLRB1 protein contains an extracellular domain with several motifs characteristic of C-type lectins, a transmembrane domain, and a cytoplasmic domain. The KLRB1 protein is classified as a type II membrane protein because it has an external C terminus. [provided by RefSeq, Jul 2008]
Mouse(100043861) killer cell lectin-like receptor subfamily B member 1
Rat(689817) killer cell lectin-like receptor subfamily B, member 1
dog(100684789) killer cell lectin-like receptor subfamily B, member 1
domestic cat(101081737) killer cell lectin-like receptor subfamily B, member 1
cow(407181) killer cell lectin-like receptor subfamily B, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002258 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045711 MISSION® esiRNA esiRNA human KLRB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002258 Rosetta Predictions human pricing
NM_001085405 Rosetta Predictions rat pricing
NM_001099918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187951 predicted 397
2 SASI_Hs01_00187952 predicted 326
3 SASI_Hs01_00187953 predicted 228
4 SASI_Hs01_00187954 predicted 415
5 SASI_Hs01_00187955 predicted 483
6 SASI_Hs01_00187956 predicted 311
7 SASI_Hs01_00187957 predicted 493
8 SASI_Hs01_00187958 predicted 354
9 SASI_Hs01_00187959 predicted 478
10 SASI_Hs01_00187960 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209031 predicted 206
2 SASI_Rn02_00209032 predicted 408
3 SASI_Rn02_00209033 predicted 372
4 SASI_Rn02_00209034 predicted 255
5 SASI_Rn02_00209035 predicted 243
6 SASI_Rn02_00209036 predicted 274
7 SASI_Rn02_00209037 predicted 298
8 SASI_Rn02_00209038 predicted 235
9 SASI_Rn02_00209039 predicted 287
10 SASI_Rn02_00209040 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302075 predicted 411
2 SASI_Mm02_00302076 predicted 395
3 SASI_Mm02_00302077 predicted 271
4 SASI_Mm02_00302078 predicted 344
5 SASI_Mm02_00302079 predicted 320
6 SASI_Mm02_00302080 predicted 241
7 SASI_Mm02_00302081 predicted 245
8 SASI_Mm02_00302082 predicted 292
9 SASI_Mm02_00302083 predicted 412
10 SASI_Mm02_00302084 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002258
KLRB1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily B, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-364s1c1
Sequence:CCGGCGAGAGAAATGCTTGTTATTTCTCGAGAAATAACAAGCATTTCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-555s1c1
Sequence:CCGGGAAGTGGATAAACGGCTCTTTCTCGAGAAAGAGCCGTTTATCCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-289s1c1
Sequence:CCGGGACATTCAACAGAGCAGGAATCTCGAGATTCCTGCTCTGTTGAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-457s1c1
Sequence:CCGGCGAGATAAGGATGAATTGATACTCGAGTATCAATTCATCCTTATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-444s1c1
Sequence:CCGGCCTGCTGCTTATTCGAGATAACTCGAGTTATCTCGAATAAGCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002258.2-699s21c1
Sequence:CCGGGAACTAACACCTGTGAGAAATCTCGAGATTTCTCACAGGTGTTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002258
KLRB1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily B, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-364s1c1
Sequence:CCGGCGAGAGAAATGCTTGTTATTTCTCGAGAAATAACAAGCATTTCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-555s1c1
Sequence:CCGGGAAGTGGATAAACGGCTCTTTCTCGAGAAAGAGCCGTTTATCCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-289s1c1
Sequence:CCGGGACATTCAACAGAGCAGGAATCTCGAGATTCCTGCTCTGTTGAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-457s1c1
Sequence:CCGGCGAGATAAGGATGAATTGATACTCGAGTATCAATTCATCCTTATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-444s1c1
Sequence:CCGGCCTGCTGCTTATTCGAGATAACTCGAGTTATCTCGAATAAGCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002258.2-699s21c1
Sequence:CCGGGAACTAACACCTGTGAGAAATCTCGAGATTTCTCACAGGTGTTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002258
KLRB1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily B, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-364s1c1
Sequence:CCGGCGAGAGAAATGCTTGTTATTTCTCGAGAAATAACAAGCATTTCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-555s1c1
Sequence:CCGGGAAGTGGATAAACGGCTCTTTCTCGAGAAAGAGCCGTTTATCCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-289s1c1
Sequence:CCGGGACATTCAACAGAGCAGGAATCTCGAGATTCCTGCTCTGTTGAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-457s1c1
Sequence:CCGGCGAGATAAGGATGAATTGATACTCGAGTATCAATTCATCCTTATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002258.1-444s1c1
Sequence:CCGGCCTGCTGCTTATTCGAGATAACTCGAGTTATCTCGAATAAGCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002258.2-699s21c1
Sequence:CCGGGAACTAACACCTGTGAGAAATCTCGAGATTTCTCACAGGTGTTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099918
KLRB1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily B, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-284s21c1
Sequence:CCGGGGCATCCACACTGTGATAAATCTCGAGATTTATCACAGTGTGGATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-173s21c1
Sequence:CCGGTAGTGGGATTCTTGGTGCAAACTCGAGTTTGCACCAAGAATCCCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-465s21c1
Sequence:CCGGTGAAGAAGTGGACAAGGTTTGCTCGAGCAAACCTTGTCCACTTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-407s21c1
Sequence:CCGGGATTATTGCAGAACTTCTCAACTCGAGTTGAGAAGTTCTGCAATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-340s21c1
Sequence:CCGGGACGGTCTGGTTGACTGTAATCTCGAGATTACAGTCAACCAGACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099918
KLRB1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily B, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-284s21c1
Sequence:CCGGGGCATCCACACTGTGATAAATCTCGAGATTTATCACAGTGTGGATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-173s21c1
Sequence:CCGGTAGTGGGATTCTTGGTGCAAACTCGAGTTTGCACCAAGAATCCCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-465s21c1
Sequence:CCGGTGAAGAAGTGGACAAGGTTTGCTCGAGCAAACCTTGTCCACTTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-407s21c1
Sequence:CCGGGATTATTGCAGAACTTCTCAACTCGAGTTGAGAAGTTCTGCAATAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-340s21c1
Sequence:CCGGGACGGTCTGGTTGACTGTAATCTCGAGATTACAGTCAACCAGACCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099918
KLRB1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily B, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-284s21c1
Sequence:CCGGGGCATCCACACTGTGATAAATCTCGAGATTTATCACAGTGTGGATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-173s21c1
Sequence:CCGGTAGTGGGATTCTTGGTGCAAACTCGAGTTTGCACCAAGAATCCCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-465s21c1
Sequence:CCGGTGAAGAAGTGGACAAGGTTTGCTCGAGCAAACCTTGTCCACTTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-407s21c1
Sequence:CCGGGATTATTGCAGAACTTCTCAACTCGAGTTGAGAAGTTCTGCAATAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099918.1-340s21c1
Sequence:CCGGGACGGTCTGGTTGACTGTAATCTCGAGATTACAGTCAACCAGACCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)