EMAIL THIS PAGE TO A FRIEND

Klrb1a

22 Gene Product Result for
Gene ID:
Rat(362443) killer cell lectin-like receptor subfamily B, member 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4700857 Monoclonal Anti-CD161 antibody produced in mouse clone 10/78 rat
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041141 MISSION® esiRNA targeting mouse Klrb1a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010964 Rosetta Predictions rat pricing
NM_010737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116998 predicted 393
2 SASI_Rn01_00116999 predicted 687
3 SASI_Rn01_00117000 predicted 370
4 SASI_Rn01_00117001 predicted 656
5 SASI_Rn01_00117002 predicted 719
6 SASI_Rn01_00117003 predicted 515
7 SASI_Rn01_00117004 predicted 273
8 SASI_Rn01_00117005 predicted 780
9 SASI_Rn01_00117006 predicted 351
10 SASI_Rn01_00117007 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105091 predicted 514
2 SASI_Mm01_00105092 predicted 814
3 SASI_Mm01_00105093 predicted 668
4 SASI_Mm01_00105094 predicted 817
5 SASI_Mm01_00105095 predicted 525
6 SASI_Mm01_00105096 predicted 509
7 SASI_Mm01_00105097 predicted 781
8 SASI_Mm01_00105098 predicted 235
9 SASI_Mm01_00105099 predicted 523
10 SASI_Mm01_00105100 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010737
Klrb1a MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-371s1c1
Sequence:CCGGGTCTAGTTGATTGTGATGGAACTCGAGTTCCATCACAATCAACTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-672s1c1
Sequence:CCGGCCTGAGCAACTATGTGGGTTACTCGAGTAACCCACATAGTTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-586s1c1
Sequence:CCGGGCTGCTATCTCAGGAGACAAACTCGAGTTTGTCTCCTGAGATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-397s1c1
Sequence:CCGGGCCACTTTGATGCTCATTCAACTCGAGTTGAATGAGCATCAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-516s1c1
Sequence:CCGGGTGGATAAATGGATCGACTTTCTCGAGAAAGTCGATCCATTTATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010737
Klrb1a MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-371s1c1
Sequence:CCGGGTCTAGTTGATTGTGATGGAACTCGAGTTCCATCACAATCAACTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-672s1c1
Sequence:CCGGCCTGAGCAACTATGTGGGTTACTCGAGTAACCCACATAGTTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-586s1c1
Sequence:CCGGGCTGCTATCTCAGGAGACAAACTCGAGTTTGTCTCCTGAGATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-397s1c1
Sequence:CCGGGCCACTTTGATGCTCATTCAACTCGAGTTGAATGAGCATCAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-516s1c1
Sequence:CCGGGTGGATAAATGGATCGACTTTCTCGAGAAAGTCGATCCATTTATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010737
Klrb1a MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-371s1c1
Sequence:CCGGGTCTAGTTGATTGTGATGGAACTCGAGTTCCATCACAATCAACTAGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000065958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-672s1c1
Sequence:CCGGCCTGAGCAACTATGTGGGTTACTCGAGTAACCCACATAGTTGCTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000065961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-586s1c1
Sequence:CCGGGCTGCTATCTCAGGAGACAAACTCGAGTTTGTCTCCTGAGATAGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000065962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-397s1c1
Sequence:CCGGGCCACTTTGATGCTCATTCAACTCGAGTTGAATGAGCATCAAAGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000065959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010737.2-516s1c1
Sequence:CCGGGTGGATAAATGGATCGACTTTCTCGAGAAAGTCGATCCATTTATCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???