EMAIL THIS PAGE TO A FRIEND

KLRC1

killer cell lectin-like receptor subfamily C, member 1

111 Gene Product Result for
Synonyms: CD159A NKG2 NKG2A
UniProtKB ID: P26715
Gene ID:
Human(3821) Summary: Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor family, also called NKG2 family, which is a group of transmembrane proteins preferentially expressed in NK cells. This family of proteins is characterized by the type II membrane orientation and the presence of a C-type lectin domain. This protein forms a complex with another family member, KLRD1/CD94, and has been implicated in the recognition of the MHC class I HLA-E molecules in NK cells. The genes of NKG2 family members form a killer cell lectin-like receptor gene cluster on chromosome 12. Four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(16641) killer cell lectin-like receptor subfamily C, member 1
Rat(29683) killer cell lectin-like receptor subfamily C, member 1
naked mole-rat(101713681) killer cell lectin-like receptor subfamily C, member 1
cow(783419) NKG2A-like
cow(514897) killer cell lectin-like receptor subfamily C, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002259 Rosetta Predictions human pricing
NM_007328 Rosetta Predictions human pricing
NM_213657 Rosetta Predictions human pricing
NM_213658 Rosetta Predictions human pricing
NM_001037441 Rosetta Predictions rat pricing
NM_010652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126704 predicted 871
2 SASI_Hs01_00126705 predicted 857
3 SASI_Hs01_00126706 predicted 852
4 SASI_Hs01_00126707 predicted 208
5 SASI_Hs01_00126708 predicted 431
6 SASI_Hs01_00126709 predicted 270
7 SASI_Hs01_00126710 predicted 462
8 SASI_Hs01_00126711 predicted 335
9 SASI_Hs01_00126712 predicted 415
10 SASI_Hs01_00126713 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165696 predicted 814
2 SASI_Hs01_00165697 predicted 805
3 SASI_Hs01_00165698 predicted 800
4 SASI_Hs01_00165699 predicted 206
5 SASI_Hs01_00165700 predicted 265
6 SASI_Hs01_00165701 predicted 417
7 SASI_Hs01_00165702 predicted 334
8 SASI_Hs01_00165703 predicted 430
9 SASI_Hs01_00165704 predicted 263
10 SASI_Hs01_00165705 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152823 predicted 813
2 SASI_Hs01_00152824 predicted 794
3 SASI_Hs01_00152825 predicted 795
4 SASI_Hs01_00152826 predicted 204
5 SASI_Hs01_00152827 predicted 258
6 SASI_Hs01_00152828 predicted 406
7 SASI_Hs01_00152829 predicted 324
8 SASI_Hs01_00152830 predicted 424
9 SASI_Hs01_00152831 predicted 263
10 SASI_Hs01_00152832 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022104 predicted 862
2 SASI_Hs01_00022105 predicted 846
3 SASI_Hs01_00022106 predicted 851
4 SASI_Hs01_00022107 predicted 199
5 SASI_Hs01_00022108 predicted 418
6 SASI_Hs01_00022109 predicted 260
7 SASI_Hs01_00022110 predicted 461
8 SASI_Hs01_00022111 predicted 329
9 SASI_Hs01_00022112 predicted 415
10 SASI_Hs01_00022113 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045200 predicted 304
2 SASI_Rn01_00045201 predicted 697
3 SASI_Rn01_00045202 predicted 777
4 SASI_Rn01_00045203 predicted 698
5 SASI_Rn01_00045204 predicted 300
6 SASI_Rn01_00045205 predicted 277
7 SASI_Rn01_00045206 predicted 241
8 SASI_Rn01_00045207 predicted 802
9 SASI_Rn01_00045208 predicted 769
10 SASI_Rn01_00045209 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179821 predicted 274
2 SASI_Mm01_00179822 predicted 273
3 SASI_Mm01_00179823 predicted 252
4 SASI_Mm01_00179824 predicted 278
5 SASI_Mm01_00179825 predicted 255
6 SASI_Mm01_00179826 predicted 213
7 SASI_Mm01_00179827 predicted 265
8 SASI_Mm01_00179828 predicted 199
9 SASI_Mm01_00179829 predicted 79
10 SASI_Mm01_00179830 predicted 116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002259
KLRC1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily C, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002259.3-1102s1c1
Sequence:CCGGGCATGTTATGTGAGTCAGCTTCTCGAGAAGCTGACTCACATAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-389s1c1
Sequence:CCGGCCTGGGAATTATCTGTCTTATCTCGAGATAAGACAGATAATTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-664s1c1
Sequence:CCGGCCATCATTTCACCATCCTCATCTCGAGATGAGGATGGTGAAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-363s1c1
Sequence:CCGGGCTCCAGAGAAGCTCATTGTTCTCGAGAACAATGAGCTTCTCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-430s1c1
Sequence:CCGGCGATAGTTGTTATTCCCTCTACTCGAGTAGAGGGAATAACAACTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002259.4-465s21c1
Sequence:CCGGTGGCCTCTGTGGTAACGATAGCTCGAGCTATCGTTACCACAGAGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002259.4-915s21c1
Sequence:CCGGAGAGGTAAAGCGTTTGCATTTCTCGAGAAATGCAAACGCTTTACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002259.4-323s21c1
Sequence:CCGGGAAATAACCTATGCGGAATTACTCGAGTAATTCCGCATAGGTTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002259
KLRC1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily C, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002259.3-1102s1c1
Sequence:CCGGGCATGTTATGTGAGTCAGCTTCTCGAGAAGCTGACTCACATAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-389s1c1
Sequence:CCGGCCTGGGAATTATCTGTCTTATCTCGAGATAAGACAGATAATTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-664s1c1
Sequence:CCGGCCATCATTTCACCATCCTCATCTCGAGATGAGGATGGTGAAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-363s1c1
Sequence:CCGGGCTCCAGAGAAGCTCATTGTTCTCGAGAACAATGAGCTTCTCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-430s1c1
Sequence:CCGGCGATAGTTGTTATTCCCTCTACTCGAGTAGAGGGAATAACAACTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002259.4-465s21c1
Sequence:CCGGTGGCCTCTGTGGTAACGATAGCTCGAGCTATCGTTACCACAGAGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002259.4-915s21c1
Sequence:CCGGAGAGGTAAAGCGTTTGCATTTCTCGAGAAATGCAAACGCTTTACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002259.4-323s21c1
Sequence:CCGGGAAATAACCTATGCGGAATTACTCGAGTAATTCCGCATAGGTTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002259
KLRC1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily C, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002259.3-1102s1c1
Sequence:CCGGGCATGTTATGTGAGTCAGCTTCTCGAGAAGCTGACTCACATAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-389s1c1
Sequence:CCGGCCTGGGAATTATCTGTCTTATCTCGAGATAAGACAGATAATTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-664s1c1
Sequence:CCGGCCATCATTTCACCATCCTCATCTCGAGATGAGGATGGTGAAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-363s1c1
Sequence:CCGGGCTCCAGAGAAGCTCATTGTTCTCGAGAACAATGAGCTTCTCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002259.3-430s1c1
Sequence:CCGGCGATAGTTGTTATTCCCTCTACTCGAGTAGAGGGAATAACAACTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002259.4-465s21c1
Sequence:CCGGTGGCCTCTGTGGTAACGATAGCTCGAGCTATCGTTACCACAGAGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002259.4-915s21c1
Sequence:CCGGAGAGGTAAAGCGTTTGCATTTCTCGAGAAATGCAAACGCTTTACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002259.4-323s21c1
Sequence:CCGGGAAATAACCTATGCGGAATTACTCGAGTAATTCCGCATAGGTTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010652
KLRC1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily C, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-202s1c1
Sequence:CCGGCCAGAGAAACTCATTGCTGGTCTCGAGACCAGCAATGAGTTTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-49s1c1
Sequence:CCGGTCAAGGAACCAGCACAGGAAACTCGAGTTTCCTGTGCTGGTTCCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-244s1c1
Sequence:CCGGGTCTTAATTGTCGCTGTGGTTCTCGAGAACCACAGCGACAATTAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-259s1c1
Sequence:CCGGGTGGTTGTAATTACTACAGTTCTCGAGAACTGTAGTAATTACAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-101s1c1
Sequence:CCGGTCGAGCAGGAAATCATCTATTCTCGAGAATAGATGATTTCCTGCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010652
KLRC1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily C, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-202s1c1
Sequence:CCGGCCAGAGAAACTCATTGCTGGTCTCGAGACCAGCAATGAGTTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-49s1c1
Sequence:CCGGTCAAGGAACCAGCACAGGAAACTCGAGTTTCCTGTGCTGGTTCCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-244s1c1
Sequence:CCGGGTCTTAATTGTCGCTGTGGTTCTCGAGAACCACAGCGACAATTAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-259s1c1
Sequence:CCGGGTGGTTGTAATTACTACAGTTCTCGAGAACTGTAGTAATTACAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-101s1c1
Sequence:CCGGTCGAGCAGGAAATCATCTATTCTCGAGAATAGATGATTTCCTGCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010652
KLRC1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily C, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-202s1c1
Sequence:CCGGCCAGAGAAACTCATTGCTGGTCTCGAGACCAGCAATGAGTTTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-49s1c1
Sequence:CCGGTCAAGGAACCAGCACAGGAAACTCGAGTTTCCTGTGCTGGTTCCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-244s1c1
Sequence:CCGGGTCTTAATTGTCGCTGTGGTTCTCGAGAACCACAGCGACAATTAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-259s1c1
Sequence:CCGGGTGGTTGTAATTACTACAGTTCTCGAGAACTGTAGTAATTACAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010652.1-101s1c1
Sequence:CCGGTCGAGCAGGAAATCATCTATTCTCGAGAATAGATGATTTCCTGCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)