EMAIL THIS PAGE TO A FRIEND

KLRC2

killer cell lectin-like receptor subfamily C, member 2

90 Gene Product Result for
Synonyms: CD159c NKG2-C NKG2C
UniProtKB ID: P26717, O43802, Q52M74, Q9NR42
Gene ID:
Human(3822) Summary: Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. The group, designated KLRC (NKG2) are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The KLRC (NKG2) gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. KLRC2 alternative splice variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(16642) killer cell lectin-like receptor subfamily C, member 2
Rat(29684) killer cell lectin-like receptor subfamily C, member 2
sheep(101123548) killer cell lectin-like receptor subfamily C, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002260 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU215171 MISSION® esiRNA esiRNA targeting mouse Klrc2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002260 Rosetta Predictions human pricing
NM_019261 Rosetta Predictions rat pricing
NM_001098669 Rosetta Predictions mouse pricing
NM_010653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218559 predicted 687
2 SASI_Hs01_00218560 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038962 predicted 266
2 SASI_Rn01_00038963 predicted 271
3 SASI_Rn01_00038964 predicted 265
4 SASI_Rn01_00038965 predicted 458
5 SASI_Rn01_00038966 predicted 338
6 SASI_Rn01_00038967 predicted 431
7 SASI_Rn01_00038968 predicted 235
8 SASI_Rn01_00038969 predicted 229
9 SASI_Rn01_00038970 predicted 236
10 SASI_Rn01_00038971 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301421 predicted 285
2 SASI_Mm02_00301422 predicted 289
3 SASI_Mm02_00301423 predicted 273
4 SASI_Mm02_00301424 predicted 245
5 SASI_Mm02_00301425 predicted 263
6 SASI_Mm02_00301426 predicted 260
7 SASI_Mm02_00301427 predicted 247
8 SASI_Mm02_00301428 predicted 237
9 SASI_Mm02_00301429 predicted 272
10 SASI_Mm02_00301430 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090342 predicted 246
2 SASI_Mm01_00090346 predicted 264
3 SASI_Mm02_00319035 predicted 328
4 SASI_Mm01_00090348 predicted 233
5 SASI_Mm02_00319036 predicted 205
6 SASI_Mm02_00319037 predicted 329
7 SASI_Mm01_00090350 predicted 218
8 SASI_Mm02_00319038 predicted 309
9 SASI_Mm01_00090351 predicted 222
10 SASI_Mm02_00319039 predicted 206
11 SASI_Mm01_00090343 predicted 747
12 SASI_Mm01_00090344 predicted 743
13 SASI_Mm01_00090345 predicted 913
14 SASI_Mm01_00090347 predicted 908
15 SASI_Mm01_00090349 predicted 910
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002260
KLRC2 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily C, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-1043s21c1
Sequence:CCGGATGACCACTAATTGATAGAACCTCGAGGTTCTATCAATTAGTGGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002260.3-703s21c1
Sequence:CCGGGAAGTAAAGCATTTGCGTTTGCTCGAGCAAACGCAAATGCTTTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-841s21c1
Sequence:CCGGGATGCACACAATTACTAAAGTCTCGAGACTTTAGTAATTGTGTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-716s21c1
Sequence:CCGGTGCGTTTGCAGTGCATCAGATCTCGAGATCTGATGCACTGCAAACGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-949s21c1
Sequence:CCGGAGTCAGCTTATAGGAAGTACCCTCGAGGGTACTTCCTATAAGCTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-669s1c1
Sequence:CCGGGCTACAAGTAAATCGACTTAACTCGAGTTAAGTCGATTTACTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-494s1c1
Sequence:CCGGCCAGTCTGCTTTCTATAGATACTCGAGTATCTATAGAAAGCAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-100s1c1
Sequence:CCGGCGGCAGCAAAGGAAACCTAAACTCGAGTTTAGGTTTCCTTTGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-696s1c1
Sequence:CCGGCCAGTGTGGATCTTCAATGATCTCGAGATCATTGAAGATCCACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-263s1c1
Sequence:CCGGCCGAGGTCCTAGGAATCATTTCTCGAGAAATGATTCCTAGGACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002260
KLRC2 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily C, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-1043s21c1
Sequence:CCGGATGACCACTAATTGATAGAACCTCGAGGTTCTATCAATTAGTGGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002260.3-703s21c1
Sequence:CCGGGAAGTAAAGCATTTGCGTTTGCTCGAGCAAACGCAAATGCTTTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-841s21c1
Sequence:CCGGGATGCACACAATTACTAAAGTCTCGAGACTTTAGTAATTGTGTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-716s21c1
Sequence:CCGGTGCGTTTGCAGTGCATCAGATCTCGAGATCTGATGCACTGCAAACGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-949s21c1
Sequence:CCGGAGTCAGCTTATAGGAAGTACCCTCGAGGGTACTTCCTATAAGCTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-669s1c1
Sequence:CCGGGCTACAAGTAAATCGACTTAACTCGAGTTAAGTCGATTTACTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-494s1c1
Sequence:CCGGCCAGTCTGCTTTCTATAGATACTCGAGTATCTATAGAAAGCAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-100s1c1
Sequence:CCGGCGGCAGCAAAGGAAACCTAAACTCGAGTTTAGGTTTCCTTTGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-696s1c1
Sequence:CCGGCCAGTGTGGATCTTCAATGATCTCGAGATCATTGAAGATCCACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-263s1c1
Sequence:CCGGCCGAGGTCCTAGGAATCATTTCTCGAGAAATGATTCCTAGGACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002260
KLRC2 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily C, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-1043s21c1
Sequence:CCGGATGACCACTAATTGATAGAACCTCGAGGTTCTATCAATTAGTGGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002260.3-703s21c1
Sequence:CCGGGAAGTAAAGCATTTGCGTTTGCTCGAGCAAACGCAAATGCTTTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-841s21c1
Sequence:CCGGGATGCACACAATTACTAAAGTCTCGAGACTTTAGTAATTGTGTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-716s21c1
Sequence:CCGGTGCGTTTGCAGTGCATCAGATCTCGAGATCTGATGCACTGCAAACGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002260.3-949s21c1
Sequence:CCGGAGTCAGCTTATAGGAAGTACCCTCGAGGGTACTTCCTATAAGCTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-669s1c1
Sequence:CCGGGCTACAAGTAAATCGACTTAACTCGAGTTAAGTCGATTTACTTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-494s1c1
Sequence:CCGGCCAGTCTGCTTTCTATAGATACTCGAGTATCTATAGAAAGCAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-100s1c1
Sequence:CCGGCGGCAGCAAAGGAAACCTAAACTCGAGTTTAGGTTTCCTTTGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-696s1c1
Sequence:CCGGCCAGTGTGGATCTTCAATGATCTCGAGATCATTGAAGATCCACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002260.2-263s1c1
Sequence:CCGGCCGAGGTCCTAGGAATCATTTCTCGAGAAATGATTCCTAGGACCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010653
KLRC2 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily C, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010653.1-871s1c1
Sequence:CCGGGCCAGGTTCAAATGTTGCATACTCGAGTATGCAACATTTGAACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-432s1c1
Sequence:CCGGCCTTCTTGGTTAGAACCCAGACTCGAGTCTGGGTTCTAACCAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-247s1c1
Sequence:CCGGCCTTCAACATGCTTCCCAGAACTCGAGTTCTGGGAAGCATGTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-737s1c1
Sequence:CCGGGCAGAGATTTCCCATGATGAACTCGAGTTCATCATGGGAAATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-170s1c1
Sequence:CCGGCCCAGGAAAGCCACAAAGAAACTCGAGTTTCTTTGTGGCTTTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010653
KLRC2 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily C, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010653.1-871s1c1
Sequence:CCGGGCCAGGTTCAAATGTTGCATACTCGAGTATGCAACATTTGAACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-432s1c1
Sequence:CCGGCCTTCTTGGTTAGAACCCAGACTCGAGTCTGGGTTCTAACCAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-247s1c1
Sequence:CCGGCCTTCAACATGCTTCCCAGAACTCGAGTTCTGGGAAGCATGTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-737s1c1
Sequence:CCGGGCAGAGATTTCCCATGATGAACTCGAGTTCATCATGGGAAATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-170s1c1
Sequence:CCGGCCCAGGAAAGCCACAAAGAAACTCGAGTTTCTTTGTGGCTTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010653
KLRC2 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily C, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010653.1-871s1c1
Sequence:CCGGGCCAGGTTCAAATGTTGCATACTCGAGTATGCAACATTTGAACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-432s1c1
Sequence:CCGGCCTTCTTGGTTAGAACCCAGACTCGAGTCTGGGTTCTAACCAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-247s1c1
Sequence:CCGGCCTTCAACATGCTTCCCAGAACTCGAGTTCTGGGAAGCATGTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-737s1c1
Sequence:CCGGGCAGAGATTTCCCATGATGAACTCGAGTTCATCATGGGAAATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010653.1-170s1c1
Sequence:CCGGCCCAGGAAAGCCACAAAGAAACTCGAGTTTCTTTGTGGCTTTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)