EMAIL THIS PAGE TO A FRIEND

KLRC3

killer cell lectin-like receptor subfamily C, member 3

57 Gene Product Result for
Synonyms: NKG2-E NKG2E
UniProtKB ID: Q07444, Q8WXA4, Q96RL0, Q9UP04
Gene ID:
Human(3823) Summary: Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. KLRC3 is a member of the NKG2 group which are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(58179) killer cell lectin-like receptor subfamily C, member 3
Rat(500338) killer cell lectin-like receptor subfamily C, member 3
dog(611325) killer cell lectin-like receptor subfamily C, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002261 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160921 MISSION® esiRNA esiRNA human KLRC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002261 Rosetta Predictions human pricing
NM_007333 Rosetta Predictions human pricing
NM_001029908 Rosetta Predictions rat pricing
NM_021378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246727 predicted 492
2 SASI_Hs01_00246728 predicted 490
3 SASI_Hs01_00246726 predicted 483
4 SASI_Hs02_00333514 predicted 465
5 SASI_Hs01_00246729 predicted 634
6 SASI_Hs01_00246730 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094942 predicted 487
2 SASI_Hs01_00094943 predicted 493
3 SASI_Hs01_00094941 predicted 491
4 SASI_Hs02_00343416 predicted 462
5 SASI_Hs01_00094944 predicted 632
6 SASI_Hs01_00094945 predicted 675
7 SASI_Hs01_00094946 predicted 785
8 SASI_Hs01_00094947 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111061 predicted 234
2 SASI_Rn01_00111062 predicted 250
3 SASI_Rn01_00111063 predicted 312
4 SASI_Rn01_00111064 predicted 347
5 SASI_Rn01_00111065 predicted 437
6 SASI_Rn01_00111067 predicted 290
7 SASI_Rn01_00111068 predicted 307
8 SASI_Rn01_00111069 predicted 434
9 SASI_Rn01_00111070 predicted 210
10 SASI_Rn02_00203473 predicted 211
11 SASI_Rn01_00111066 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161242 predicted 256
2 SASI_Mm01_00161243 predicted 327
3 SASI_Mm01_00161244 predicted 315
4 SASI_Mm01_00161245 predicted 317
5 SASI_Mm01_00161246 predicted 301
6 SASI_Mm01_00161247 predicted 246
7 SASI_Mm01_00161248 predicted 309
8 SASI_Mm01_00161250 predicted 276
9 SASI_Mm01_00161251 predicted 219
10 SASI_Mm02_00325970 predicted 220
11 SASI_Mm01_00161249 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002261
KLRC3 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily C, member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-354s1c1
Sequence:CCGGCCCGAATACAAGAACGCAGAACTCGAGTTCTGCGTTCTTGTATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-492s1c1
Sequence:CCGGCTCTTCTAGTCTGCTTTCTATCTCGAGATAGAAAGCAGACTAGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-100s1c1
Sequence:CCGGCCGCAGCAAAGGAAACCTAAACTCGAGTTTAGGTTTCCTTTGCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-683s1c1
Sequence:CCGGGTGGACTTATATCAGACCAGTCTCGAGACTGGTCTGATATAAGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002261.2-705s21c1
Sequence:CCGGTGGATCTTCAAGAATCATTAGCTCGAGCTAATGATTCTTGAAGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002261.2-835s21c1
Sequence:CCGGGAGTGCTCATGTACCATTTAGCTCGAGCTAAATGGTACATGAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002261
KLRC3 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily C, member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-354s1c1
Sequence:CCGGCCCGAATACAAGAACGCAGAACTCGAGTTCTGCGTTCTTGTATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-492s1c1
Sequence:CCGGCTCTTCTAGTCTGCTTTCTATCTCGAGATAGAAAGCAGACTAGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-100s1c1
Sequence:CCGGCCGCAGCAAAGGAAACCTAAACTCGAGTTTAGGTTTCCTTTGCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-683s1c1
Sequence:CCGGGTGGACTTATATCAGACCAGTCTCGAGACTGGTCTGATATAAGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002261.2-705s21c1
Sequence:CCGGTGGATCTTCAAGAATCATTAGCTCGAGCTAATGATTCTTGAAGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002261.2-835s21c1
Sequence:CCGGGAGTGCTCATGTACCATTTAGCTCGAGCTAAATGGTACATGAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002261
KLRC3 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily C, member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-354s1c1
Sequence:CCGGCCCGAATACAAGAACGCAGAACTCGAGTTCTGCGTTCTTGTATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-492s1c1
Sequence:CCGGCTCTTCTAGTCTGCTTTCTATCTCGAGATAGAAAGCAGACTAGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-100s1c1
Sequence:CCGGCCGCAGCAAAGGAAACCTAAACTCGAGTTTAGGTTTCCTTTGCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002261.1-683s1c1
Sequence:CCGGGTGGACTTATATCAGACCAGTCTCGAGACTGGTCTGATATAAGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002261.2-705s21c1
Sequence:CCGGTGGATCTTCAAGAATCATTAGCTCGAGCTAATGATTCTTGAAGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002261.2-835s21c1
Sequence:CCGGGAGTGCTCATGTACCATTTAGCTCGAGCTAAATGGTACATGAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021378
KLRC3 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily C, member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-316s1c1
Sequence:CCGGCCAAAGGAATGGATCTTATATCTCGAGATATAAGATCCATTCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-293s1c1
Sequence:CCGGCAGCACAAACTTATGCTCTTTCTCGAGAAAGAGCATAAGTTTGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-227s1c1
Sequence:CCGGCCTTATTGATTGCTCTAGTAACTCGAGTTACTAGAGCAATCAATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-254s1c1
Sequence:CCGGCCAGAATTGTTTCTCCATATACTCGAGTATATGGAGAAACAATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-347s1c1
Sequence:CCGGGTTATTACATTGGCATGGAAACTCGAGTTTCCATGCCAATGTAATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-447s21c1
Sequence:CCGGGGACTTTCTGCAATCCCTTTCCTCGAGGAAAGGGATTGCAGAAAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-327s21c1
Sequence:CCGGGATCTTATATTCTCACAATTGCTCGAGCAATTGTGAGAATATAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-614s21c1
Sequence:CCGGACAGCTGTACAACTTTACATCCTCGAGGATGTAAAGTTGTACAGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-67s21c1
Sequence:CCGGCAGCTCCGTTTCAGTAATGCACTCGAGTGCATTACTGAAACGGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-459s21c1
Sequence:CCGGATCCCTTTCACTGGTCTCATGCTCGAGCATGAGACCAGTGAAAGGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021378
KLRC3 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily C, member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-316s1c1
Sequence:CCGGCCAAAGGAATGGATCTTATATCTCGAGATATAAGATCCATTCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-293s1c1
Sequence:CCGGCAGCACAAACTTATGCTCTTTCTCGAGAAAGAGCATAAGTTTGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-227s1c1
Sequence:CCGGCCTTATTGATTGCTCTAGTAACTCGAGTTACTAGAGCAATCAATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-254s1c1
Sequence:CCGGCCAGAATTGTTTCTCCATATACTCGAGTATATGGAGAAACAATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-347s1c1
Sequence:CCGGGTTATTACATTGGCATGGAAACTCGAGTTTCCATGCCAATGTAATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-447s21c1
Sequence:CCGGGGACTTTCTGCAATCCCTTTCCTCGAGGAAAGGGATTGCAGAAAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-327s21c1
Sequence:CCGGGATCTTATATTCTCACAATTGCTCGAGCAATTGTGAGAATATAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-614s21c1
Sequence:CCGGACAGCTGTACAACTTTACATCCTCGAGGATGTAAAGTTGTACAGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-67s21c1
Sequence:CCGGCAGCTCCGTTTCAGTAATGCACTCGAGTGCATTACTGAAACGGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-459s21c1
Sequence:CCGGATCCCTTTCACTGGTCTCATGCTCGAGCATGAGACCAGTGAAAGGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021378
KLRC3 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily C, member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-316s1c1
Sequence:CCGGCCAAAGGAATGGATCTTATATCTCGAGATATAAGATCCATTCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-293s1c1
Sequence:CCGGCAGCACAAACTTATGCTCTTTCTCGAGAAAGAGCATAAGTTTGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-227s1c1
Sequence:CCGGCCTTATTGATTGCTCTAGTAACTCGAGTTACTAGAGCAATCAATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-254s1c1
Sequence:CCGGCCAGAATTGTTTCTCCATATACTCGAGTATATGGAGAAACAATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021378.1-347s1c1
Sequence:CCGGGTTATTACATTGGCATGGAAACTCGAGTTTCCATGCCAATGTAATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-447s21c1
Sequence:CCGGGGACTTTCTGCAATCCCTTTCCTCGAGGAAAGGGATTGCAGAAAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-327s21c1
Sequence:CCGGGATCTTATATTCTCACAATTGCTCGAGCAATTGTGAGAATATAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-614s21c1
Sequence:CCGGACAGCTGTACAACTTTACATCCTCGAGGATGTAAAGTTGTACAGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-67s21c1
Sequence:CCGGCAGCTCCGTTTCAGTAATGCACTCGAGTGCATTACTGAAACGGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021378.1-459s21c1
Sequence:CCGGATCCCTTTCACTGGTCTCATGCTCGAGCATGAGACCAGTGAAAGGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)