EMAIL THIS PAGE TO A FRIEND

KLRC4

killer cell lectin-like receptor subfamily C, member 4

21 Gene Product Result for
Synonyms: NKG2-F NKG2F
Species: Human KLRC4(8302)
UniProtKB ID: O43908, O60851
Gene ID:
Human(8302) Summary: Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. This gene is a member of the NKG2 group of genes that are expressed primarily in natural killer (NK) cells. These family members encode transmembrane proteins that are characterized by a type II membrane orientation (have an extracellular C-terminus) and the presence of a C-type lectin domain. This family member is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed in NK cells. Read-through transcription exists between this gene and the downstream KLRK1 (killer cell lectin-like receptor subfamily K, member 1) family member. [provided by RefSeq, Dec 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013431 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013431 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142771 predicted 341
2 SASI_Hs01_00142772 predicted 352
3 SASI_Hs01_00142773 predicted 238
4 SASI_Hs01_00142774 predicted 242
5 SASI_Hs01_00142775 predicted 241
6 SASI_Hs01_00142776 predicted 344
7 SASI_Hs01_00142777 predicted 467
8 SASI_Hs01_00142778 predicted 350
9 SASI_Hs01_00142779 predicted 349
10 SASI_Hs02_00344820 predicted 323
11 SASI_Hs01_00142780 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013431
KLRC4 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily C, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013431.2-670s21c1
Sequence:CCGGAGAAATGGTAAGACGTAAATGCTCGAGCATTTACGTCTTACCATTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013431.2-354s21c1
Sequence:CCGGACATATCACTGCAAAGGTTTACTCGAGTAAACCTTTGCAGTGATATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-500s1c1
Sequence:CCGGCCTGAATAGAAGAATGCAGAACTCGAGTTCTGCATTCTTCTATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-327s1c1
Sequence:CCGGTCTTCGGATCATCAAGGGAATCTCGAGATTCCCTTGATGATCCGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-459s1c1
Sequence:CCGGCTTATTCCTTGTATTGGAGTACTCGAGTACTCCAATACAAGGAATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-331s1c1
Sequence:CCGGCGGATCATCAAGGGAATGACACTCGAGTGTCATTCCCTTGATGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013431.2-718s21c1
Sequence:CCGGCTGTCAATATCATATTTGTAGCTCGAGCTACAAATATGATATTGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-633s1c1
Sequence:CCGGCGAAGAACTCTGATCTGCTTTCTCGAGAAAGCAGATCAGAGTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013431
KLRC4 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily C, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013431.2-670s21c1
Sequence:CCGGAGAAATGGTAAGACGTAAATGCTCGAGCATTTACGTCTTACCATTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013431.2-354s21c1
Sequence:CCGGACATATCACTGCAAAGGTTTACTCGAGTAAACCTTTGCAGTGATATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-500s1c1
Sequence:CCGGCCTGAATAGAAGAATGCAGAACTCGAGTTCTGCATTCTTCTATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-327s1c1
Sequence:CCGGTCTTCGGATCATCAAGGGAATCTCGAGATTCCCTTGATGATCCGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-459s1c1
Sequence:CCGGCTTATTCCTTGTATTGGAGTACTCGAGTACTCCAATACAAGGAATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-331s1c1
Sequence:CCGGCGGATCATCAAGGGAATGACACTCGAGTGTCATTCCCTTGATGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013431.2-718s21c1
Sequence:CCGGCTGTCAATATCATATTTGTAGCTCGAGCTACAAATATGATATTGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-633s1c1
Sequence:CCGGCGAAGAACTCTGATCTGCTTTCTCGAGAAAGCAGATCAGAGTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013431
KLRC4 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily C, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013431.2-670s21c1
Sequence:CCGGAGAAATGGTAAGACGTAAATGCTCGAGCATTTACGTCTTACCATTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013431.2-354s21c1
Sequence:CCGGACATATCACTGCAAAGGTTTACTCGAGTAAACCTTTGCAGTGATATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-500s1c1
Sequence:CCGGCCTGAATAGAAGAATGCAGAACTCGAGTTCTGCATTCTTCTATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-327s1c1
Sequence:CCGGTCTTCGGATCATCAAGGGAATCTCGAGATTCCCTTGATGATCCGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-459s1c1
Sequence:CCGGCTTATTCCTTGTATTGGAGTACTCGAGTACTCCAATACAAGGAATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-331s1c1
Sequence:CCGGCGGATCATCAAGGGAATGACACTCGAGTGTCATTCCCTTGATGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013431.2-718s21c1
Sequence:CCGGCTGTCAATATCATATTTGTAGCTCGAGCTACAAATATGATATTGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013431.1-633s1c1
Sequence:CCGGCGAAGAACTCTGATCTGCTTTCTCGAGAAAGCAGATCAGAGTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)