EMAIL THIS PAGE TO A FRIEND

KLRD1

killer cell lectin-like receptor subfamily D, member 1

115 Gene Product Result for
Synonyms: CD94
UniProtKB ID: Q13241, O43321, O43773, Q9UBE3, Q9UEQ0
Gene ID:
Human(3824) Summary: Natural killer (NK) cells are a distinct lineage of lymphocytes that mediate cytotoxic activity and secrete cytokines upon immune stimulation. Several genes of the C-type lectin superfamily, including members of the NKG2 family, are expressed by NK cells and may be involved in the regulation of NK cell function. KLRD1 (CD94) is an antigen preferentially expressed on NK cells and is classified as a type II membrane protein because it has an external C terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16643) killer cell lectin-like receptor, subfamily D, member 1
Rat(25110) killer cell lectin-like receptor, subfamily D, member 1
domestic cat(101086731) killer cell lectin-like receptor subfamily D, member 1
cow(444877) killer cell lectin-like receptor subfamily D, member 1
Horse(100062540) killer cell lectin-like receptor subfamily D, member 1
dog(611360) killer cell lectin-like receptor subfamily D, member 1
domestic guinea pig(100724475) killer cell lectin-like receptor subfamily D, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002262 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114396 Rosetta Predictions human pricing
NM_002262 Rosetta Predictions human pricing
NM_007334 Rosetta Predictions human pricing
NM_012745 Rosetta Predictions rat pricing
NM_010654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326604 predicted 642
2 SASI_Hs02_00326605 predicted 678
3 SASI_Hs02_00326606 predicted 591
4 SASI_Hs02_00326607 predicted 593
5 SASI_Hs02_00326608 predicted 545
6 SASI_Hs02_00326609 predicted 651
7 SASI_Hs02_00326610 predicted 646
8 SASI_Hs02_00326611 predicted 648
9 SASI_Hs02_00326612 predicted 591
10 SASI_Hs02_00326613 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333515 predicted 701
2 SASI_Hs02_00333516 predicted 737
3 SASI_Hs01_00150452 predicted 658
4 SASI_Hs01_00150453 predicted 659
5 SASI_Hs02_00333517 predicted 613
6 SASI_Hs02_00333518 predicted 711
7 SASI_Hs01_00150455 predicted 711
8 SASI_Hs02_00333519 predicted 706
9 SASI_Hs02_00333520 predicted 661
10 SASI_Hs02_00333521 predicted 732
11 SASI_Hs01_00150448 predicted 866
12 SASI_Hs01_00150449 predicted 928
13 SASI_Hs01_00150450 predicted 862
14 SASI_Hs01_00150451 predicted 674
15 SASI_Hs01_00150454 predicted 889
16 SASI_Hs01_00150456 predicted 936
17 SASI_Hs01_00150457 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343417 predicted 605
2 SASI_Hs02_00343418 predicted 646
3 SASI_Hs01_00095828 predicted 562
4 SASI_Hs01_00095829 predicted 565
5 SASI_Hs02_00343419 predicted 520
6 SASI_Hs02_00343420 predicted 617
7 SASI_Hs01_00095831 predicted 619
8 SASI_Hs02_00343421 predicted 612
9 SASI_Hs02_00343422 predicted 561
10 SASI_Hs02_00343423 predicted 635
11 SASI_Hs01_00095824 predicted 765
12 SASI_Hs01_00095825 predicted 838
13 SASI_Hs01_00095826 predicted 762
14 SASI_Hs01_00095827 predicted 576
15 SASI_Hs01_00095830 predicted 797
16 SASI_Hs01_00095832 predicted 849
17 SASI_Hs01_00095833 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075202 predicted 1024
2 SASI_Rn01_00075204 predicted 1029
3 SASI_Rn01_00075205 predicted 957
4 SASI_Rn01_00075206 predicted 538
5 SASI_Rn01_00075208 predicted 659
6 SASI_Rn01_00075209 predicted 801
7 SASI_Rn01_00075210 predicted 709
8 SASI_Rn01_00075211 predicted 625
9 SASI_Rn02_00260099 predicted 716
10 SASI_Rn02_00260100 predicted 915
11 SASI_Rn01_00075203 predicted 1069
12 SASI_Rn01_00075207 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319040 predicted 251
2 SASI_Mm02_00319041 predicted 344
3 SASI_Mm02_00319042 predicted 447
4 SASI_Mm02_00319043 predicted 386
5 SASI_Mm02_00319044 predicted 204
6 SASI_Mm02_00319045 predicted 434
7 SASI_Mm02_00319046 predicted 379
8 SASI_Mm02_00319047 predicted 323
9 SASI_Mm02_00319048 predicted 369
10 SASI_Mm02_00319049 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002262
KLRD1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily D, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-464s1c1
Sequence:CCGGCCGGTGCAACTGTTACTTCATCTCGAGATGAAGTAACAGTTGCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-320s1c1
Sequence:CCGGCCTTTCGTTGATGGCTACGTTCTCGAGAACGTAGCCATCAACGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-671s1c1
Sequence:CCGGCCAGTATCTATTTCCATCATTCTCGAGAATGATGGAAATAGATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-402s1c1
Sequence:CCGGCCCAACATAGAACTCCAGAAACTCGAGTTTCTGGAGTTCTATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-304s1c1
Sequence:CCGGCCTTAGGGATAATATGCCTTTCTCGAGAAAGGCATATTATCCCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002262.3-834s21c1
Sequence:CCGGGACCCAACATTACTAACAATGCTCGAGCATTGTTAGTAATGTTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002262.3-709s21c1
Sequence:CCGGAGAACTGCATAGCGTATAATCCTCGAGGATTATACGCTATGCAGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002262.3-970s21c1
Sequence:CCGGGAAATTCGTTCACCTACATTTCTCGAGAAATGTAGGTGAACGAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002262
KLRD1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily D, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-464s1c1
Sequence:CCGGCCGGTGCAACTGTTACTTCATCTCGAGATGAAGTAACAGTTGCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-320s1c1
Sequence:CCGGCCTTTCGTTGATGGCTACGTTCTCGAGAACGTAGCCATCAACGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-671s1c1
Sequence:CCGGCCAGTATCTATTTCCATCATTCTCGAGAATGATGGAAATAGATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-402s1c1
Sequence:CCGGCCCAACATAGAACTCCAGAAACTCGAGTTTCTGGAGTTCTATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-304s1c1
Sequence:CCGGCCTTAGGGATAATATGCCTTTCTCGAGAAAGGCATATTATCCCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002262.3-834s21c1
Sequence:CCGGGACCCAACATTACTAACAATGCTCGAGCATTGTTAGTAATGTTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002262.3-709s21c1
Sequence:CCGGAGAACTGCATAGCGTATAATCCTCGAGGATTATACGCTATGCAGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002262.3-970s21c1
Sequence:CCGGGAAATTCGTTCACCTACATTTCTCGAGAAATGTAGGTGAACGAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002262
KLRD1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily D, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-464s1c1
Sequence:CCGGCCGGTGCAACTGTTACTTCATCTCGAGATGAAGTAACAGTTGCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-320s1c1
Sequence:CCGGCCTTTCGTTGATGGCTACGTTCTCGAGAACGTAGCCATCAACGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-671s1c1
Sequence:CCGGCCAGTATCTATTTCCATCATTCTCGAGAATGATGGAAATAGATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-402s1c1
Sequence:CCGGCCCAACATAGAACTCCAGAAACTCGAGTTTCTGGAGTTCTATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002262.2-304s1c1
Sequence:CCGGCCTTAGGGATAATATGCCTTTCTCGAGAAAGGCATATTATCCCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002262.3-834s21c1
Sequence:CCGGGACCCAACATTACTAACAATGCTCGAGCATTGTTAGTAATGTTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002262.3-709s21c1
Sequence:CCGGAGAACTGCATAGCGTATAATCCTCGAGGATTATACGCTATGCAGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002262.3-970s21c1
Sequence:CCGGGAAATTCGTTCACCTACATTTCTCGAGAAATGTAGGTGAACGAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010654
KLRD1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily D, member 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010654.1-601s1c1
Sequence:CCGGGCTCTCAATATTACTACCTTTCTCGAGAAAGGTAGTAATATTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-444s1c1
Sequence:CCGGGCCAGAGCACTGCATTGTTTACTCGAGTAAACAATGCAGTGCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-68s1c1
Sequence:CCGGTGATGGTTACTTTGGGAGTTTCTCGAGAAACTCCCAAAGTAACCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-518s1c1
Sequence:CCGGTCTGTAAGAAACTGCCTATTTCTCGAGAAATAGGCAGTTTCTTACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-27s1c1
Sequence:CCGGGAGACTGATGTCTGTCATCTTCTCGAGAAGATGACAGACATCAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010654.2-199s21c1
Sequence:CCGGGGGCATCAGTGCAATTGTTACCTCGAGGTAACAATTGCACTGATGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010654.2-322s21c1
Sequence:CCGGATGAACTTCAGTCAAACCTTTCTCGAGAAAGGTTTGACTGAAGTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010654
KLRD1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily D, member 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010654.1-601s1c1
Sequence:CCGGGCTCTCAATATTACTACCTTTCTCGAGAAAGGTAGTAATATTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-444s1c1
Sequence:CCGGGCCAGAGCACTGCATTGTTTACTCGAGTAAACAATGCAGTGCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-68s1c1
Sequence:CCGGTGATGGTTACTTTGGGAGTTTCTCGAGAAACTCCCAAAGTAACCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-518s1c1
Sequence:CCGGTCTGTAAGAAACTGCCTATTTCTCGAGAAATAGGCAGTTTCTTACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-27s1c1
Sequence:CCGGGAGACTGATGTCTGTCATCTTCTCGAGAAGATGACAGACATCAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010654.2-199s21c1
Sequence:CCGGGGGCATCAGTGCAATTGTTACCTCGAGGTAACAATTGCACTGATGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010654.2-322s21c1
Sequence:CCGGATGAACTTCAGTCAAACCTTTCTCGAGAAAGGTTTGACTGAAGTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010654
KLRD1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily D, member 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010654.1-601s1c1
Sequence:CCGGGCTCTCAATATTACTACCTTTCTCGAGAAAGGTAGTAATATTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-444s1c1
Sequence:CCGGGCCAGAGCACTGCATTGTTTACTCGAGTAAACAATGCAGTGCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-68s1c1
Sequence:CCGGTGATGGTTACTTTGGGAGTTTCTCGAGAAACTCCCAAAGTAACCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-518s1c1
Sequence:CCGGTCTGTAAGAAACTGCCTATTTCTCGAGAAATAGGCAGTTTCTTACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010654.1-27s1c1
Sequence:CCGGGAGACTGATGTCTGTCATCTTCTCGAGAAGATGACAGACATCAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010654.2-199s21c1
Sequence:CCGGGGGCATCAGTGCAATTGTTACCTCGAGGTAACAATTGCACTGATGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010654.2-322s21c1
Sequence:CCGGATGAACTTCAGTCAAACCTTTCTCGAGAAAGGTTTGACTGAAGTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)