EMAIL THIS PAGE TO A FRIEND

KLRF1

killer cell lectin-like receptor subfamily F, member 1

87 Gene Product Result for
Synonyms: CLEC5C NKp80
UniProtKB ID: Q9NZS2, Q4KMT5, Q96PR2, Q96PR3, Q9NZS1
Gene ID:
Human(51348) Summary: KLRF1, an activating homodimeric C-type lectin-like receptor (CTLR), is expressed on nearly all natural killer (NK) cells and stimulates their cytoxicity and cytokine release (Kuttruff et al., 2009 [PubMed 18922855]
sheep(101121250) killer cell lectin-like receptor subfamily F, member 1
cow(784491) killer cell lectin-like receptor subfamily F, member 1
domestic cat(101082756) killer cell lectin-like receptor subfamily F, member 1
dog(611429) killer cell lectin-like receptor subfamily F, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105684 Anti-KLRF1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4301090 Anti-KLRF1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016523 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062761 MISSION® esiRNA esiRNA human KLRF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016523 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056495 predicted 580
2 SASI_Hs01_00056496 predicted 358
3 SASI_Hs01_00056497 predicted 806
4 SASI_Hs01_00056499 predicted 426
5 SASI_Hs01_00056500 predicted 651
6 SASI_Hs01_00056501 predicted 280
7 SASI_Hs02_00349621 predicted 275
8 SASI_Hs01_00056504 predicted 573
9 SASI_Hs02_00349622 predicted 579
10 SASI_Hs02_00349623 predicted 624
11 SASI_Hs01_00056498 predicted 338
12 SASI_Hs01_00056502 predicted 214
13 SASI_Hs01_00056503 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016523
KLRF1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily F, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-574s1c1
Sequence:CCGGCGTATGGATTGGGCTTAACTTCTCGAGAAGTTAAGCCCAATCCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-427s1c1
Sequence:CCGGCCAAGGGAAGTGTTATTGGTTCTCGAGAACCAATAACACTTCCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-202s1c1
Sequence:CCGGCGTGAATGGTATTCTCACTTTCTCGAGAAAGTGAGAATACCATTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-406s1c1
Sequence:CCGGCCAATCAGAATGGCTCAAATACTCGAGTATTTGAGCCATTCTGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-120s1c1
Sequence:CCGGCTGCCCAAACATCTCAACTTACTCGAGTAAGTTGAGATGTTTGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016523.1-746s21c1
Sequence:CCGGATTTGTCAGTATTAGAGTTTGCTCGAGCAAACTCTAATACTGACAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016523
KLRF1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily F, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-574s1c1
Sequence:CCGGCGTATGGATTGGGCTTAACTTCTCGAGAAGTTAAGCCCAATCCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-427s1c1
Sequence:CCGGCCAAGGGAAGTGTTATTGGTTCTCGAGAACCAATAACACTTCCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-202s1c1
Sequence:CCGGCGTGAATGGTATTCTCACTTTCTCGAGAAAGTGAGAATACCATTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-406s1c1
Sequence:CCGGCCAATCAGAATGGCTCAAATACTCGAGTATTTGAGCCATTCTGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-120s1c1
Sequence:CCGGCTGCCCAAACATCTCAACTTACTCGAGTAAGTTGAGATGTTTGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016523.1-746s21c1
Sequence:CCGGATTTGTCAGTATTAGAGTTTGCTCGAGCAAACTCTAATACTGACAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016523
KLRF1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily F, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-574s1c1
Sequence:CCGGCGTATGGATTGGGCTTAACTTCTCGAGAAGTTAAGCCCAATCCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-427s1c1
Sequence:CCGGCCAAGGGAAGTGTTATTGGTTCTCGAGAACCAATAACACTTCCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-202s1c1
Sequence:CCGGCGTGAATGGTATTCTCACTTTCTCGAGAAAGTGAGAATACCATTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-406s1c1
Sequence:CCGGCCAATCAGAATGGCTCAAATACTCGAGTATTTGAGCCATTCTGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016523.1-120s1c1
Sequence:CCGGCTGCCCAAACATCTCAACTTACTCGAGTAAGTTGAGATGTTTGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016523.1-746s21c1
Sequence:CCGGATTTGTCAGTATTAGAGTTTGCTCGAGCAAACTCTAATACTGACAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)